Description :
From Genome Similarity Track
Location :
Scaffold_4042:1- 1593
Sequence
1591 bases(100 bases per row)
ACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCTTATGCTGCCAAGGGACATCCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCG
CGGGTACGGTATGTATTCATCGACCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAAGCTGCCGTCGCTTCTGTTCCCAGATTGCGACAGCCT
TCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTGCCGCGACACCG
TTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGGCTTCTTTATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCC
CGAGAGCCACTCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTCCTCGTGCTTGAGATTGCACTT
GGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGGTGGAGCGAGAGGTCGCGA
GCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCC
GCCTGCGGCCCACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGAAGCCCCTCCA
GCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGACTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGC
TGGGTCAAGGGGGATCTGCAAATCAGCAACCCCCTGCGGGTCAAATTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGAA
AGTTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTA
GAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAAATATACTTAAGTTTCCTCTTCCTTGTTTGTCTGAGTACTCCTTTTGTTTATCTTG
GGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAG
ACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTATGGGGTGGCGGAAGCCGT
TCAAGTAGAACGGCGTGAACCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGACGACCACGTACGTGGCGCTGCCGCG
CACACAATGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAG