Description :
From Genome Similarity Track
Location :
Scaffold_4021:1- 1585
Sequence
1584 bases(100 bases per row)
TCTGGATCCGCATCTCGTCAGGGAAACAAAGTGTCCCATCCGCTAGATCCAACCTCACTCCGGCCGGTACCATGAAATCCATCCCGAGGATGGCGTCTTG
ACCAGCGAGATCTCCAACTCAAATGTCAAACCAATACACCAAACAACCTGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCGTACGGTACACGCCTTCA
CCAATCCCAACACAGTCTTGGATCCGACTCCCATACACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACACCTCGGCACCACTATCTA
GGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCACTTTCCTGGGGCATGGTACTTCCAGTATCCACGGGACTCCCC
TGTTAGCAGATCCATGGATCCAACATCCTCAGATCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGGTCTGCAGTGACCTCAGCCTTGGTAGGCTCA
AACCATCGACCTTGTCGGCGCTTCTCCCAATAACCACGTGCCTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACTTCGGATCTGGCAAACTCATCCACTT
GGCGCAAACTAGAGATCTTGGCAGCTGGCACTTCATGTAGATCACGTGGATTATCGACTGGATCTAGGGTCCTGCTACCTGGATCTAGCGATGTCTTGTT
CACAAATGCATAAATGCAATACCTAGAACGTTCGGCTCGTACCGGATTCAAATCCGGCGAACGTCCTAGTTTAACATCTTCTCGGCCACTTCTGGCAACA
TCCCTCGGTGCTTGGCTGGATCAAACCACTGGCGGATCTGGTTGTAGAATTCCTCCATCGGACACTTGCCGACGTCGTGAATCCCGCCACAACCGCGACA
CACGTAGAAGCAATGATCCCCGGGATGCCCTTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCTGTGTGCTTCCGGGATCCGCAC
TGCGAACACCTGACTTGTGCTGTCCCGTCCATGAAATCTCGGGATCTTTACATCCCACGGTCCCCGGGTACGGTATCCCCCGGTCGAGAGTTGTCTCCTG
TCTTCGCCGTTCGATCGTTGGACGCAGTGAGACAGACTCGACGATAATCTTCCGGGTCGGAGTCCGAACCGTCGGATCCTGATTCAGTTCCTTAGTCGGG
CACCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTAAGCGTCGGAGCTTTTTGGCGATACTTGCCGGATCCGACTGCCGCCTTCTTCTGGCGGTGTTTC
GCGCGATCCACCGCCCGCAGCACTTCTTCAAGCTCGTCTGCGTCGGGAAGTCGTAACAGGGTCAGCCTGTCGGCCAGATCCACGTCTCCCAACGTCTCGA
TGAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGTCGATGTAGGTATTCTAG
CGGGGATACATCTGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTGGGTCTGGAAACT