Description :
From Genome Similarity Track
Location :
Scaffold_3577:1- 1583
Transcript NameFunction/comments
Phyta_totarag15368hypothetical protein

Sequence
1581 bases(100 bases per row)
GCGCGGGGCACCCTACTGGTAAAGCAGTCACGCGTGTCGACATTGGACACGCGTGAATGAGgactgcagcttccagcgaGATGCAATCTCACTCCAACAG
GCGAGATGACAAACCAGACCTTGTCATCCTGGACTTGGCGTCGAAGAGAGCGAACTCTCTGCGTGCCTTGGTAGACTCAAGTGCGTCGAACAACTTTGTT
CGACAGCAAAAGGCTATTAAACCTTGACTTCAAGGAGGTACAAACACCTCGAAGCGTATTGGAAGTGCGACTGGCAACAGGTGCCATCGTGAAAACCGAG
AAGCGTTTCGTAGGCGTACGCTTCTCGTATCAACAAAAGGAATTTGTTGAAAATCTTATCGTCTTGATttagacgacaagttcgacttggtgctgggcat
gccGTGGCTTGCACGGTATGACCCAAAGatggactggaagaagcgtaCGAGTTTACGCTTCGGTTGCGACAGCGCGACAGTGAGCGGTAGCCCTGTCATA
ACACAAGCATCGCGAGATGCATGCAACTTTCCCGTAGAGATAGCGCTAAACGCTGCTGTCTCAATGAGCGAAACTCTGAAGAGTTCGAAAGTCGTTGGAA
CTAAATGTGGGTCGGATCTGGGAAACGACTCTGATAATCTGATAAACCCAGACTTAAAGGATGATTCCGCCACAAAGGAACATtgtgacggcgacgagtC
AGATCTGGGAGCTGACGCAAATCTGATTGGATCCGGTTCTGCAGAAAACGCCGTTGAAAggcgtcgaggcgacgaaggcgcgtcAGGTCAGGGAGTTGAC
GCTTCGAGTAGTGCGGATGGTTGCAAACGTCCAGCACAAGAAAAGTTTGCGAGCTCACGTGCAGACGGcctgcacgaagaagcggcaCGTGAAGCCAGGC
TTGGTGAAGCGCGCCCGCTGATACAATCTTCCGGCGACGACACCACGAACCCGTCCACGGCTGGTCCTGGACGAGAAACACGCGGAGCCGGCCTccgcaa
gagcaagaaagaCAGCGCTAGtagaagaagctgcgcgagccTCGGGCCGGGCCCGAGACGGTAAATCAGATGTCTGCCGAGCAGACATTAAGGCCGACGT
CAAGCGTCGAGACATTGAATGCCTTGACGCAGACCAGTACTGGGTTACAGTACAGAAGTATGACACTTGAGAACCCTCCGACGAGCGCGTCGGTGTTGAC
GTCGCTTCCGGtcatgagctggaagcgcttcgcGCGCGGCTTGCTCGATGCGCCCATCGTGCAAATCTGCATCCTTTCAGACAAGGAAAGATTGAAATGT
GAAGCGGCAGAGTTGAAGCAACTCATCGCTGGCAGTACCACTGAGAGTGAGGACACtctcagcgccaagacgaagaagcagcgcttcgaagagcagagct
gggactcgctcaagtcgagtcCCTATTACGACGTTCTGCGAGAGTACAGAGACGTACTCCCGGACTATACCCCTGCGGAACTCCCGCAGGACAAGGGAAT
TCAGCACGAGATTGATCTCGTGCCGGGCTCGAAGTACTGTGTcacgcggcagtggccactgccgcgagAGCAAGTGAAGGC