Description :
From Genome Similarity Track
Location :
Scaffold_517:1- 1573
Sequence
1572 bases(100 bases per row)
TCGTCAACCTTATTCGAAGACGTACGCAAGGCGTACGATCCGGCGATGGTGCGTTTGATGGATCATCTCTCGCAACCATCTCGTCAATCCCTTAAAAGGT
TTCCCCCAGTATATCGATCCTCCACGGATAGATATACAGTCCAAAATGGCTTACTGAAGTATACAGCCGTTGCCGGCGACACGCCTCGTGTCGTCGTACC
GGACCATCGTGACCTGCGACTGCGCATCATGTATGAGTACCACGATGCACCTACTGGTGGACATCGTGGTCGAGAGAATACATATCTCACAGTTAGTCGC
GACTTTTACTGGCTCCGCCAGTATCAGTTCGTGCGAAAGTACGTCCGCGCATGCGAAGTATGTCAACGAGTGAAGTCAGGTCCTTCACTTCGTGTGCCGT
TGCAACCCTTGCCCATTCCGGCAGGGTGCTGGGAATCAGTCTCAATGGACTTTGTCTTTGGATTCCCCGCAGACCCACACAAGAATACAGGTATTCTTGT
GTTCGTTGATAGATTCAGTAAAAGGGTACACCTGGTCACTGTACCTGAATCTATCAATGCATCGGCATGTGCTCGTGTCTTTATTATCACGATCTTTCGT
CTTCATGGGTTGCCTCGTGAACTCGTCTCTGATCGAGACCCACGATTCACTGCGGAATTCTGGCGATCCGTGTTCAAAACACTCGGAACGCGCCTTCAGA
TGTCGACCTCTGACCACCCTGAAACAGATGGTCAGACAAAACGTGCAAACCGCGTTCTTGAGGAGATCCTTCGGGGTTATGTCCATTCGTTTACAAATTG
GAGAGAATTCTTGCCAATGATGGAATTCGCCATCAACAACTCGGTGCATGCATCGATGACGCATACACCGTTCTTCGTGAATGGCTAGCGCCACCCACGC
CTACCCACCTTATTAGAGTGTACCTCTAGTTTGAGGGGGGAGGGAATCATTCAAGCGAACGCCAAGTCGGCTCTCACTCTTCACGTACTGATCTCGAGGT
CACTACGTATGACGCCGATGTCGATCACATCGACTTCGGTGAAGAAGAGGAAAGTAAGAGCGAGGATGCTCTTACTACCCAGGTCACTGATCTTGCCACA
GTGCGCTCCAAGCGCACTACAGCCAAAGACAGCGAGTCAGCAGATGGATTCATACTGGCTCGTGAAACGGGTTGTCCGTTTCGTGCAAGATTCCATTGCT
GAAGCAGTGGACCGACAAAAAAAACGCAGACAGAATGGAAGGGCAAATGTTCTTTCATTCANNNNNNNNNNCAGATTCCATTGCTGAAGCAGTGGACCGA
CAAAAAAAAACGCAGACAAGAATGGAAGGGCAAATGTTCTTTCATTCAATGAAGGTGAACTATTCCTACTATCTACGGTAAACTTACCTCGACACATAGT
GACTAACGTGGGTAGTAACAAGTTACTACCCAAGTTCATCGGTCCATTTCGTGTGCTGCGCCGCATAGGCAACGCATGCACGATTGAAAACTGCCACGTC
AGATGCGCACGCATCCTACGTTTATGTCGGTCGCCTTAGACCTTATCACCAGTACAGGACTTCTTCCGGTGA