Description :
From Genome Similarity Track
Location :
Scaffold_4057:1- 1570
Sequence
1569 bases(100 bases per row)
TTAACCCCTCCACTTTCACGCAGAGGCTCTGTCGCTTCCGCGGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGGCTTCTCCATTCCGTCA
AAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCCGACGCCTCCTGAGAGCCGCTCTTGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACC
CTGAGGTTGACCCGCCTCCGTCAATGTGTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGAGGTAATGCTGCCGCCCAGGCCCGGGAATCAGGGC
GAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCTATCTGGACG
AGGCCTTTTTGCATGATCCGACGAATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAGACGTACGCGTATGGTGCGTACCCGGCGT
ACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGACTTAAGTGCCTGCTCC
AACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAAAAGGATCTGCGAGTCAGCAACCCCCTGCAGGTCAAAGTACCGCTTAA
GACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAA
GCGGTGCTTCAGTTTGTTGCTGCCGACAGAGCTAACGGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAATCTCAAATATACTTAAG
CTTCCTCTTCCTTGTTTGTCTGAGTACTCCTTTTTGTTTAATTATGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCAT
AAAGGATTTCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGCGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCA
GTGTCTCCTCGAAGAGTGAGAGGCACTCTGAAGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAA
ACTCAACAACTGGAAGCTGCGACGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCC
GTCTGTCTGCGGATGATCCGCAGTGGACATATGCAGATCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGAC
AATCGTCTCCGGGAGACCGTGATAGCGGAACACGCCATCGACGAACAACCTTGCGTTTTGTTCGCCCGTTACAGTGACGGGAACTGGAGCAAGATGTACC
ATCTTGCTCAGCCGACACACGAACACCAAAATTCCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAG