Description :
From Genome Similarity Track
Location :
Scaffold_3563:1- 1563
Transcript NameFunction/comments
Phypl_g15904putative polyprotein

Sequence
1561 bases(100 bases per row)
GTCCAGGTCGTAACGCGTGATGTACTCACGCGTTGGACGCGTCAGCTTCGACAGAGTCTCCGTCGACGGATTGCGGTGATGTTGGAGAATCGCGGCGTAG
AAGGAGTCCTCCTCGTACGCGTCAGCGATCCGCTGGCGCAGCGGAAGGATGGTGCTCGACAccatggcgttgatgccCAGTGCCACACAGACAGCAcagt
cttcgtcgtcgtcctcgtcatcagGAAGGTCCTGATGACGCGTCAAGCGCCGCGGGTCATAGTTTGGACGCCAAGAGAGAGCGTCAGCGAGAATGTTGTT
CTTGCCGGGCTTGTAGTGCACAACGAAGTTGTACTCCGCGAAGAAAGAAAGCCATCGTGTCATGCGCTGAGAGAGATGGgggctcttcatcgccgtACAA
AGCGAAGCGTGATCCGTGTACACCGCGAACGTTTGCTCGCCGAGGAGGTACACTCTGAATTTGATCAGAGCGTAACGCATCGCGAGAAGTTCCTTGTCGT
GCACTGGATAGTTCTTTTCCGCCGGCTTCATCTGTCGTGATTGATAACTCACGACGCGTTTGCGGCCCTCACTGTCGAACTGCATGAACGCGCATCCGAT
GGCGAAGTCACTCGCGTCACAAACGACATGGAAGGATCTTGACATATCTGGAAGCATCAAGATGGGCGCGAACGCAAGACTCTTCTTCACGGCCTCGAAC
GCATCCTGATGCTCAGGGCGCCAGATCTatgccgcgtccttcttcaaCAAGGACGAGAGCGGCTGGATCAGGTCTGCGTAGTCCTTGGTGTACTTGTGGA
GGTGGTTCGCGAGACCGAGCCATTGACACAGCTCCGTCGGGTTCTTGGGAGTAGGCCAAGAAcagatcgacgagatctTTTCCGGGTCGGCGCGGACACC
GCTCTTGCTAACGTAGCAGCCGAGAACCGGAATTTCCGGGGCACAGAACACGCACTTCTTGAGGTTAGCGTACAGCTTGTTGTCGCGCATCTTCTGGAAC
ACCTGGCGCAGGTGTTGTAGATGGACGTTGATAGCGCTGAGGCCATCCTTAGCGCGGCTGTGCACGAAGATGACATCGAAGTAGCTCGGTGCGAATTCGC
GGAGCgggtgcagcacgtgggACACCATGCGGTTGAACGTGGCGGGCGCATTCTTCAAGCCTTGTGGTATGACGAGCCACTCCCAGAGCATTCCGCTGGG
AGTGCTTACTGCGGTCAGAGGCACGTCTTTTCCTGGCATGAGGATCTGATAGAAGCCGTCCGTCAGATCAACCGCGATGTAGACGACGCTGTCAGACATG
GCGTCTAGCACCATGTCTTTCCGGGGGATCGGTGTCTGCGCTGGGATGGTGGCGTCGTTCAACTTGTTGAACGCATGAACGATGCGCCAGGCTCCTGTAG
CCTTCTCCACGCAAAACGTCGGGCTCGAGTGTGGAGATGTGCTCTCCCGTACGTGCCCGGTCTTGTGAAGACcctcgaagaagtcgtcgatggcaTGGAC
CTGGTCTCGCGGCAGCGGCCACTGCCGCTTCACGCAGTATTTCGATCCAGGCACGAGGTCG