Description :
From Genome Similarity Track
Location :
Scaffold_2233:1- 1561
Transcript NameFunction/comments
Phymu_g13977hypothetical protein PHYSODRAFT_344705

Sequence
1559 bases(100 bases per row)
TTgttggcctcgtcctccgacttGTACTTCTCGGCCTCCGACACCATGCGGTCAATGTCAGCCTGCGAGAGGCGGCCCTTGTCGTTCGTGATCGtgatct
tgttctccttgCCCGTCGACTTCTCCACCGCCGACACGTTCAGGATGCCGTTCGCGTCGATGTCGAACGTCACGTCAATCTGCGGCACGCCGCGAGGCAT
GGGCGGGATGCCGTCCAGGTTGAACTTGCCCAGCAGGTTGTTGTCGCGCGTCATCGAGCGCTCGCCCTCGAACACCTGGATGAGCACACCAGGCTGGTTG
TCGGCGTACGTCGAGAACGTCTGCGACTTCTTGGTCGGCACCGTCGTGTTGCGCGcgatcagcgtcgtcatgaCACCGCCGGCCGTCTCCAGACCCAGAG
ACAGCGgcgtcacgtccagcagaagcaggtcctgcagcttctccgacGAGTCGTTGCCGCTCAGGATGGCCGCCTGCACGGTCGCACCGTACGCCACAGC
CTCGTCCGGGTTGATCGACTTGTTGGGCTccttgccgttgaagaagtccgacagcagctgctgcaccttcgGGATACGCGTCGAGCCGCCCACTAGCACC
ACCTCGTGCACCTGGCTCTTCGACAGCTTGGCGTCGcgcagcaccttctccacgggCTCCATCGTCTTGCGGAAGTAGTCGCCGCACATGTCCTCGAAAC
GAGCGCGAGTGATGgtcgagttgaagtcgaTGCCGTCGAACAGAGAGTCAATCTCGATGTAAGCCTgagccgacgacgacagcgtaCGCTTCGCACGCTC
GCACGCCGTCcgcagacgacgaagagcgcgcTGGTTCTCCGTGATGTCCTTGCGGtgcttgcgcttgaactCCTGCGTGAAGTGGTCCACCAGGCGGTTG
TCGAAGTCCTCACCACCCAGGTGCGTGTCACCAGCAGTGGCCTTCACCTCGAAGATGCCCTCCTCGATGGACAGGAGGGACACATCGAAGGTGCCGCCGC
CCAGGTCGAAGATCAGCACGTTGCGCTCGCCGCCCTTCTTGTCCAGGCCGTACGCGATGGCGGCGGCCGTCGGCTCGTTGATGATACGGAGCACGTTGAG
GCCGGCAATGGCGCCGGCGTCCTTGGTGGCCTGACGCTGCGAGTCGTTGAAGTAGGCCGGCACGGTGATGACGGCGTTCTTGACCTCCTTGCCGATGAAG
GCCTCGGCCACCTCGCGCATCTTGATCAGCaccatggacgagatctccTCGGGCTGGAACGTCTTGGACTCGCCCTTGAACTGCACCGTGATCTGCGGCT
TGTCGCCGGCGCCCGACGTCAGCTTGAACGGCCAGTGCTTGATGTCCGACTGGACGATGGGGTCCGAGAACTTGCGGCCGATGAGACGCTTGGCGTCGAA
CACCGTGTTGTGCGCGTTCATGGCCACCTGATTCTTGGCGGCATCACCGATCAGACGCTCGGTGTCCGTGAAGGCAACGTACGAAGGGGTGGTGCGGTTA
CCCTggtcgttggcgatgatctcCACGCGGTCGTTCTGCCACACGCCGACGCACGAGTA