Description :
From Genome Similarity Track
Location :
Scaffold_2360:1- 1556
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_2360-fgenesh-gene-0.0Cyclin-H
Pytiw_DAOMBR242034maker-piw_contig_2360-fgenesh-gene-0.1Coiled-coil domain-containing protein 12.

Sequence
1555 bases(100 bases per row)
CAAACGCTTCTACCTGTCGAACAGCGTCATGGAGTTCCACCCAAAGTTCATCGTGCCCACGGCGATCTACGTGGCCGGCAAGGTCGAGGAGCAGTACATC
TCGGTCGACACGGTCGCCGAGCAGCTCCACGTGGACCACAAGCACGTGATTGGCCACGAGATGGTGCTCCTCGAGGGCACGCGCTTCCAGCTCATCATGT
ACCACCCGTTCCGCGCGCTCCTGGGCTTTGTCGACGACTTCCGCGGCTACGCCAAGGCGCGCGGCAAGGACTTGCCGCTCGACATGCTCCAGAAGCTCCA
CTCCAACTCGTGCGTGATCGTGAACGACATGCTGCTGACCGACCTGCCGTTCACGTACTACCCGCCGTTCCTGGCGCTCGCCGCGCTCGCCCACGTCGTC
GAAGAGCTGGGCAGTCTCGACACGAGCGCCTCGAGTGCACTGACCAAGGCCGACGTGCTCGAGTACATCCGCCGCAGTAAGTTCGCCCAGTCCGACCAGA
TCGACCAAGTCGTGACGCAGATGGACGCGATTCGAAGTGCGTACCTAAGCTTCAAGCACGCGCAGGTGGCCAAGGAAAAGGATACCGAGGCGCTCGCAAA
GCAGCTCAAGACGCTCTACAAGACGCTCAAGAGCTTCCACGAGGAGGAGAAGAGCGCCAAGGACAAGAAGGAGAAGAAGAGCAAGAAGGATGACGGCGGC
AAGAAGCGCAAGAGTGGCGACAAGGACGAGAAGAAGAAGGCCAAAAAGGCCAAGAAGGAAAAAAAGTAAACACCTATAGGCCTGTGTGCACAGGGCGATG
TGGGTCGTCATATATATATGCTGGCGAGTATCCGTTGATAACTTTGATGAGCTACAGTGTAGCGCTGGGGGTCAATAGCAAAAAAATAAATGGCGAGGGC
GGGACGGAGAGCTGGGAAACATGATACCAAACGGCGAGTTACTTCGTAATAGATACAGAGACGCATTATTCCTCCTCTTCTTCGTCTTCTTCTTCGTCGT
CGTCGTCTTCCTCTTCTTGCTCCGCCGCCAGCTTCTCGCCTGCATAATAGAAATAATAAAACATAGCAATATTGTAAGGCAACATGAGTGCCCTGTAATA
AATGTATAGAGTGAGAATGCAAGCACTGATTGAATGGTACGTACGCAAGATCTCGACGATGGCGAACTGCGTGCGCTTCTCCAGCTTCTTGAGCATCGGC
GCGATGTCGCGCTCAATGTCCCAGTTCGCGCGCTTTGGCGCCAAATTCAGCAGCTCGCTGTCGTCTTCGTCGTCTTCATCTTCTGCGGCTGCGTGCGTCT
TGTCCTGCGGCTGTTCAGTTACAGCAATAGCAGCAAACTCGTCACTTTTGTCTTCGCCGTCGGTGTCTTCGCTTGCGTTGCGCTTCTGGGACTTGTCAAT
AGCCACGCTCTCGACGCCAGCACCGATCTCCTCGACCGCCTCGCCGCGATCGATGCGCTCCTTGCGGTCCTTCGCCTCGCGCAGCATCTTGAGGCGCTTC
GCGCGCGGCATGGCGTCCTCCATGGCGGCCATTCTGTCAATCTGCTTGTGCTTGG