Description :
From Genome Similarity Track
Location :
Scaffold_435:1- 1536
Sequence
1535 bases(100 bases per row)
TGGCGAAGCGCTTGTTCATTTGGACAAATGACGGCCCTTGGAGCCTTCGTCCAAGGTCATTTCGTTTAAGGACGTTGTGATCGATATTCGATTCTTCCTC
GTCATTCCCGGGACGATTAGCGGTGGCGCATTCGCGCAGCGAGCGAAACAGATTCGAACGTTTCAGAGAACCGGATGCGGTGTCCGCAGGTCTCTTCTTG
TTGGAGATCGCGCCGTTGAGCGGCTAGACCTCACAGAGGAAGCTGGGGAAGACGCGGCACCAGCGTGCGACCTCGGAGAGGTTGGGTTGGAGTGATCCTC
ACTACCCATGGGCTCGTCGTAATCGACTTCGCCCTCTTCGAGTTCCGAGAACAGACCATCGTTCCCTCTGGGCGGCGCCCGCGGCTCTGACGAGCTTTGA
GCTTTGCTCTCTTCTTGTTGACGGCTCATGGAGCGTTGACCGTGTCGACGGCGATACTCTTGGTGGTACTCCGCCACCGAAAGAGACGAAGATGCTCTTG
GAGCAGTTGCGGAGCGCAGTTGGGGGTCTGGGACCGACGAGGCAGGGGCGGCGCGACGCGCTGGAGACGTTGAGCCGTGGGCCGGAGTGGGAGTGCCAGG
CATCAAGGATGCGAACGCGTTTGTGAGCTCGTGGAGCTGCAGAACGCACAGGTGAGGTCTAGTGACCTCCGTCGTCTTGACAAGACGTGACCTCGCTGAG
GAAAGTTCGAGAACGGAATGTTCTCATCTTAGTGAGGGAGAGTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCGGCGAGTTAAC
AAACTCTCAGTACATAAGTTGGAGAGTTAACAAGGTCTCTCAGTACGTTGGCTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAG
TTAAAGAGATACATTTACCCCTAGGCGGCTTGGCCGCAATAATAGTAAATAAATCACTTCTGGTTTTGAAGCATAAAAGTTAAGGTGTTAACTTTGAGCC
CTGGTCTTGGGCTGTAAGTGTCCTTTGGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGGCAGCCCCGC
TGCAATTCTCGTTCCTTTCACTTGGTTGCTTTGTTCGTCGTGTCACAACAAGAAGAGCGTCACTACGCGAGTGCGCTTGCATCCCTCCGCGCTATCTACG
CTCGATTTTTGCGGAAGCCGATGGTAGTGCACTACATTCTTGGAGACGCCGACGGAGCCAGTACAATGCGATGGCATCAGTGTTCGAGGATTGTGAAACA
GAGATTTTGATGTGCTTTTACCACGTTATCGCAAAAGTTCATGAGCGGACGAGGTATCTACTACCCGGTAAGCGTAGCCTGGTCTAGGCCGATATATTTG
ATATGCATTACGCAAGAAACGCCTCCAAATTTCATGCTAAAAAGACGTCTGCAGTGCGGCGGTGGCTTGCCGACCCAGATGTCGAGCGATTTGGAGAGTA
TTTTCTGCAGCAGTGGCTGACGGGAAAGTTTGTGA