Description :
From Genome Similarity Track
Location :
Scaffold_3637:1- 1519
Sequence
1517 bases(100 bases per row)
CTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGTTTCGTAACACAGAACGTCAGAGCACTGTGCGAGGACTTGGATTCCCGTACTTGACTGCCT
CGCGACGACTCTCAAGATGTCGTCAACTGCTTTTACTTTCTCTCGTGGCAGTTGCCGCTGCCGCGTGACACAGTAATTTGCGCCCGGCACGAGGTCAATC
TCGTGCTGGATTCCCTTGTCCTGTGGGAGCTCCGCAGGAATTTCGTCCGGGAGTACGTCTTTGTACTCTCGCAGAATGTCGTAATAGGgactcgacttga
gcgagtccCAACTCTATTCTTTGAAGCGCTGTTTCTTTGTCTTGGAGCTGAGAGTGTCCTCACTCTCAGTGGTACTGCCAGCAAATAGTTGTTTTAACTC
TTCCGCctcgcacttcaaccttTCCTTGTCTGAAAGGATGCagatctgctcgatgcgtCCATCGTGCAAGTCGCGCGCAAagtgcttccagctcatgaCT
GGAAGCGACGTCAACTCCGACACACTCGTCGGAGGGCTCTCAAAAGTCATACGCCTGTACTGTAACCCAGTACCGGTCTGCGTCAAGACATTCAATGTCT
CGACGCTTGACATCTGGTTTACTGCCTCGGTCCCGGGCCAGGCTCGCGCAATTTCGTTTGCTTGCGCTGTTTTGCTTGCTTTCACGGAGCCCGGCTCCGT
GTATTCCTCGTTCAGGCCCAGccgtggacgagttcatTTTGTTGTCGCCGGCAGATTCTATCCGCAGGAGCGCGTCATCAAGCCCGGCTTGGTGCGCAct
cgcttcttcgtgcagccctGCTAGACGTGAGCTTGCAAGCTTGGCTTGTTCGGGACGTTTGCAACCGTCTGCACTGCACCCAGCGTCAACCCCTTGAGCT
gacgcgccttcgtcgcctaGACGCCTTTCGGCGAAGCTTTCTGCCGAATCGGGTTCGCGTCAGGCCCCAGAGCTGACCCGTTGCCGTGACAATGTCCCTT
TGTGGCGGAATCGTTCTTTAATTCTCAGTTTATCAGATTCTCAGTGTTGTTACCCAGAACCGACATACATTCACTTCCGACGACTTCCGGAGTCGTTGGA
GTTCTCCTCATTCTCGCCCTGCGCGTCGAGACAGCAGCGTTTAGCGCTGTCTCTACTGGAAGGAAACATGCACCTCACGGTGCATGTGTCGCGCTGTCGC
AATCGAAACTTACAATTGTATGTTTCTACTTTGGGGCATGCACAGCGCcaagtcgaacttgtcgttTAAATCTAAGACGATAAGAGCTTCAACAAATTTC
TTTTGTTGATACGAGAAGCGTACGCGTACGACACGCTTCTAAGTTTTCACGACGGCACCTGTTAccagtcgtacttccaatacgcttcgaggtgtttaca
cctcctcgaagtcaCAGCTTGATAGACTTTGTTGTCGAACAAAGTTGTTCGACGCACCTGAATCTACCAAGGCCCGAAGAGAGTCCGCTCTCTTCGATgt
cacgtccaggatgacaa