Description :
From Genome Similarity Track
Location :
Scaffold_3598:1- 1515
Transcript NameFunction/comments
Phypl_g15928reverse transcriptase

Sequence
1514 bases(100 bases per row)
GATCGTGACACGATCCTAAAGCTTGTCATTCCGGAGACGctccgcgacgacgagttgcACCACTATCACGCGAGCTTGGAGGGCGGCCATCAAGGCATCG
GCCGGACGTATCAGCGGCTGCGACGCCACTTCCACTGGCCGGGCATCTTCCGAAGCGTACAGCGCTACGTAGGAGAGTGCACAGACTATGAAACTGGGAA
GGGTCGGCCGACGATCCAAGGCGAGTCGCCGGGGAATATCGTCGCGACCTACCCGTTCCAAGTCCTGGCGATGGATCAAACCCCGTCCTTGCCCGCGTCG
CACAAGGGCAACACCGAGTTGCTCGTCTGGGTGGATTTGTTCACGGGGTTCGTCGTCGCGAAGGCGAACTTGTCACGAGCGGCGCAGACGGTGGCCGAGG
CGTACGAAGAGGCCGTCTTCCGGCGGTTCGGCGCGAGCGAAGTGGTCAGACACGACCGGGAGCCAGGCTTCATGTCCGACTTTTTCAAGGCATTCAACAA
GCTAATGGGCCAGCGACAACGGGCGACACTCGCCTACCGACCGCAGGCGAATGGCGCTGCGGAACGCATGGTACAGACGATCACAAGAGCGATTAAGATG
TACACCGAGGACATTGACCAGCGCGACTGGGACGAGTATGCGGAAAGGCTTACCTTCGCGTTGAACACGGCCCACGATCGCACGAGGAATGAAACCCCTT
TCTACCTTGTGCACGGATGGGACCCGAGATCGACACTGGAATCGACGCTGTCTGTCGGCAACACGTCTCACCGCGAGACTGaggccaggcgctggcgatT
GCGGATCCAGAGGCACTACAAGATcgcacgagctcaagcgtTGGAGTTAGTCCGAGAGGCAGTCGAAGCGAGAGCACGTCAGCAGAACGAGATCGCGACG
GAACACGCGATTGAAGCCGGAGGACGAGTGTGGCTTAACCTGGATCGAGTAAAGCCGGGGTACGCGCGCAAGCTGGCGCACATGTGACATGGGCCGTtcc
gcgtcgtcgagctggtggacacgTACGCCGCACGACTTGAGACGAGCGGTACGCCTTATCAGCTCTACCCGGTCGTGCACatctccaagttgaagcccgT
CCGGGAGTTCCCGGCGCGCCCGGCGATGCCACTGACGGTGCCGGCCGGTGAGCGTTTCGATTTTGATGAAGAGCTCTTGCCAGAGGACAGCTGGGAAGCA
GAGGAATTGGATGATGACACCTTCGAGGTCGAAGAGATCCTAGACATGCGCGAGGGTCGAGCCACGCGATATGGCCGTACGCGGCGCGAATTCGAAGTGA
GGTAGAAGGGTTACCCAGACACAACGTGGGTCGATGAGCTGGACCTCAACTGCGGCGGAGTGCTGTGCGACTTCTTGAGACAGCGCACGGGGCGCAACCG
GTTCGCCGTGACACAATCGCGCGAGAACGCGACGGCGGAGCCCGACCAAGGTGGGTGAACGCCTTGATGGGTGCGGTGAGAGTCGGCAGGGGGGCTGCCG
ACGGGAGAAATGGT