Description :
From Genome Similarity Track
Location :
Scaffold_2166:1- 1513
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_2166-fgenesh-gene-0.0Lysosomal alpha-mannosidase

Sequence
1511 bases(100 bases per row)
GACTCGGTTTCGTTCAGATGCTCGCCGACGCCTTTATTGTCATCTTCGAGAAGTCGTCGATGCACCATGACCTCCAACTGGCCATCCTGCAAACTCGCCG
CACCCTGCGCTCGATCAGTGGCGATGTTTAGCTGGTGATCCGAGTCTTTGATGTAAGCTCCCGTCGTGATGGGGAAGTAATTGGCCGCTACCCGCTCCGA
GTCGTCATGCAGCACGAGATTCCATGTATCACGATGGTCGCGGACCCTCTTCACAAATTCCAACCCATTCGAGTCAGTGTACACTGTCTTGTCCGACTTG
ATGCTGCCCTTCGTATCAAAGCGGACAATGACTTCCTTGCCGATATTGTCACCAATGGGAACTGGTCCGACCGTCCACTCAATCTCAACGAACTCGTCGC
CGTCATTCAGCCGGTACTCCAACATCACCCAGTCGCCAATCTTGAACGCAACTCGAGACGCACTGGAAAGGTCCGAGTCCAGACCAAGATCAACCAATGT
GGCAGACGGATGTCCATTTGCACTTTGCCCGACAGGGTACGTCTTGTTTCCATCTGGGCGGAAGGCGTACGCGCCTGAGCACGGATGGTCCTTCGAGTAC
GCGTGGTAGTACTCTACAGTCGCTGAAAGCGGCAGTTCGATCCCCTTCTTCTTGTTGACTAACTTCGCGATGAACCCAGTCTGTGTGTTGATGTCCACTC
GCACCAAGTCATTCTCCAGTGACACCGTCTTGTCGTCACCGATCACATTCTTCTTGCTGGCATCATCATCATCGTCATCAACGGTACGCATATTGGCCGA
GTTGGAGGCACCCTTTTGCCTCACACGGAACCGCGTCGCGCTCAACGGAGAAAGCTCAGTGCTGAACACCAACGAATAAGGCGCCACATCTGCTTCGGGG
TGCGCAGGCAGCGCCTTGAACACGTCCTGATGGCGAACCACACCACTGCCGTCAATAACATCCACCATGGCCAACGGGTGTGTCAACGGAATCGATATCG
TCTCGACAGTCTTCCGAGCAAGCGCGTTGTGGACAAGCACTTCAAACTCCTGCATTGCAAACCGTCCGTCAATACCTTGAGTCGCACTCGTGCGGAATAG
CAACATAGAACATACCTGGTTTTTGGTCGACACATCGCACACGCTGGTGTTCGCCAGCAAACACAAGTGGAACGGCTCCTTGGCGCCAATCACGAACAGG
ATCTCGTTCAGCCCCTTCTCAGCCTCGATGACGCCGTCATTTAGTCGCAGCGCGTAATCGTTCGAAACAGCCTGCTTCTCCGTGCCCGACAGCCCGTCGT
GGTGCTGGACTAGACCCACTGCGCGCTGCAGCGCATGCAACTCAGCGGTATGGTGACTCTGATACACCGCGTCGATCTGACGGACTTGCTGCAGCAGAAT
GTTCGAGACACGCGCAAATCGCTTGAGCGTGGGGCGACTTGTGAAGAAACCCGACCAATAGTCGTCTTGGCCTGATGCGTACGGGAAGAAGTCGTCGGTC
TTGACGGCCCA