Description :
From Genome Similarity Track
Location :
Scaffold_642:1- 1510
Sequence
1509 bases(100 bases per row)
CGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACCGGCCTACCC
TTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTCTACCCCATACAAACGCCTTGTCGAGTAGTCATCGCACGATAGTAAT
ACCATGGAACGGAGCACATTCTGAAACGTAGAGTCCCCATGTTTCAGAGCTCTAACGTTGATATTGAGGAAGTTGTAAGAAAGTCCATAACGGCTCGTCC
GTTGAGAAATAGTAGTACCATTGAACTCCGCACATGTTGAAACGTAGAATCCTACGTTTTCAATGCTCTAACGTTACTATTAAAGAAGTGTGTAAAAAGT
ACAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCGCCATATGTATAAACACGGATTCCCAAGTTTTCAGCTACTCCTGACGATGGTAG
TTTTTCTATCTCCTGATTGGCTAGGAAGCTGTGCTGTCGAGGTTTATGCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGC
CCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATATAGGAAACCCGACCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGACG
TTCATATAGGAAAGCCGAGCCAATAAATGAGGACCGGAGACCGGCCTACCTTCTCCGGTTTGTCTTGATTTACTATAACTGTCCTCTCGTGTTTATAGGG
ACCCTCTACCCCATACAAAACGCCTTGTCGATAGTCATCGCACGATAGTATACCATGAACGGAGCACTCTGAACGTGATCCCCATGCATTCAGAGCTCTA
CGATTGATATTGAGGAAGTTGTAAGAAAGTCCATACACGGCTTCGTCCGTTGAGACATAGTAGTACCATTTGAACTCCGCACATGTTGAAACGTAGAATC
CTACGTTCTCAATGCTCTTACGTTACTATTAAAGAAGAAGTGTGTAAAAAGTATCAGAGAGGCAAGTCTTTGACACACGCGAGTCGGTGCATTCAATTCG
CCATATGTATAAACATGGATTCCCAAGTTTTCAGCTACACCTGACGATGGTAGTTTTTCTATCTCCTGATTGGCTATGAAGCTGTGCTGTCGAGGTTTAT
GCACTAACCCTGAATGACTTGGATTTCTATGCATGACTTCGAGTTTGTATGGCCCCCCGAACATGATAAATTGACCGAAAATGGTCGCGGAGTTTTCATA
TAGGAAACCCGAGCCAAAAATGGGAGGACACTCACCTCGGAGAAGACCCGGAGCGTTCATATAGGAAAGCCGAGCCAATAAATGGAGGACACGGAGCACC
GGCCTACCCTTCTCCGGTTTGTCTTGATTTCACTATACTGTCCTCTCGTGTATAGGGACCCTAAACCCTACCAGCGGTTTAGCGGTTTAGCGGTTTATTA
AACCCTAGC