Description :
From Genome Similarity Track
Location :
Scaffold_1635:1- 1506
Sequence
1505 bases(100 bases per row)
GCGTCGTTACGCACTGCGACACAGTCGCCTCATCTCTCTCAGAGAATGGCAAGATGGCTTTCCTTCTTTGCCGAGTATAACTTCGAGGTGAAGTACAAGC
CGGGGCGGCTTAATGTAGTGGCCGATGCGCTCTCGCGCAGGCCGGACTACGAGTTAGCTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACG
CGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGCTACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGC
GCGAGGCTGCATCGATACTCACTCGATGGCGGCCTGCTGTACTACAGCACCGACGCTGAGGATAACCCTCGTGTAGTCGTTCCTCATGATGAGGATCTAA
AGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTGGGCGGGCACTTAGGTCGGGAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCAA
GATGTATAAGTGGGTCGGCACCTATGTACGCACGTGTGAGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTC
CCCAAGGGATGCTGGCAGTCCATGAGTATGGACTTTGTGTTTGGCCTTCCCAAGGATAAGGCAAGAAACACAGGTATAGTGGTCTTTGTATACCGATTGA
GCAAGATGGCTCATTTAGCGGCAGTGCCGGACACCATTGATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTATTTCGCCAACATGGCTTGCCTGA
GGCAATTGTCTCGGATCGAGATCCGCGCTTCACCGCGAAGTTCTGGGACGTCTCTCTTCAGAGTGCTCGGCACTCGTTTGGACATGTCCACAGCGGACCA
TCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGTTGTGGAGGATACCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTC
CCACCTCGTTGAGTTCGCATTAAATAATGCAGTGCACGCCTCGACAGGCTACACTCCGTTCTATGTGAACGGCTTGGTTAACCCTCGCGTCCCACTGACG
CCGCCACGCAGTGGCTCAGGGCTTGATGGGGGAGGGATAGCCGAGCGGCTAGCTGATGTCAGCCCTGTTGCGGCTCGCAAGCAAGTCGATGACTTTGTCT
CTTTGAGACTGAGCGTAATGCGTCAAGTACGCGACGCTATGGCTGAAAGCCAAGACACGCAGAAGGAACATGCAGATGCCAAGGGCAGAAGCAATGTTGA
GAGGTTTGAGGTCGGTGACCAAGTTTTATTAAGCGCTAAAAACCTATCTACTCATGCAGTGTCTGCAGTCTTCAAGACGAAGTTAAGACCTCGGCTCATA
GGACCGTTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCTTCCGAAGAAGATGCGCACGCATCCGGTCTTCTATGTCGGCTTGCTTAAGC
CATAC