Description :
From Genome Similarity Track
Location :
Scaffold_3619:1- 1502
Transcript NameFunction/comments
Phypl_g15939reverse transcriptase

Sequence
1500 bases(100 bases per row)
GACACCGACATCGCCAAACGTCGGGTCTGGGGCCACCTCAGACTGAAGTCGCCTCGCGCGACTCGGAGCCGAAGGCCAAGGCTCCTCAGACGAGGCCCGT
CGAAGAGTGTCACCACGTCTTCGACGGAGAGACCGGTTTACGGGTCAAGGCAGGCGCTGCCCATTTGGAGGCGTTGCCGGAGGTAGCGGAACGGCTAAAC
CTCGAAGAAACGCCGATGGACGAGTTAAAGGCCGGCTCGTCCTCTCCAATGGACGAGGATGTCCTCGAGGAGTTCCTaagcagcgcgcgacgcgCTTGGG
TTCTGAGGTGCTCAATAACCGGAAGGATCCGACGTACGCCTTGGTGAAGGAGTTCGTGGATGTGGTGTCGAAGAACCCACCATCCCAACTCCCACCTGAT
ATGGGGATCAGGCAGGAGATCGGCCGCGTCCCACGAGACAATGACCTCTACCTCGCGAGCAGTGCGAGGTCATTGATGCCTTCTCCGCCGCGAAAACGAA
GGTTGGCATGGTGCGGGGGTCAAAGTCCCCGCACTCGACGCCCACCTTCTGCGTTCGGAAACCGAACGGGAAGTGGCGCTGGTTCATGCTTAGAACAAGC
TGAACAGCGCTACGGTGCCAGCCCAGACGCCCATCCCGCGAAAGGATGTGTTGTTGAGCAGCATGACTGGCTGCACACTTTACAGCGCGGTGAATCTGGT
TGACGGATATTATCCGATCCTGATGCCGCAGAGTGACATCCCTCTCACAGCGGTCAGCACTCCGAGCGGTATGCTCTGGGAGTGGCTGGTATTGCCCCAA
GGGCTGTCGAACGCGCCTGCAACGTTCAATCGTCTAGTGTCGCAGCTGTTCAGGCCCCACAGGGCGTACGCCCAGACATACTTCGACGACATATTCGTGT
CGTGCACGGAAAGACTGACGTGGAGAACCACATTGAGCACCTGCGAGCAGTGCTCGAGTGCATGCGCACACACAAGTTGTATGCCAACATCGACAAGTGT
GTCTTCGGCGCTGAAGAGATCCCCTTTCTGAGATGCTTCATTGGGAAGCGAGGCCTTCGAGCGGATCCCGCTAAGGTCAAGGCCATTGTAGACTGGCCGG
TTCCAAAGAACCAGAAGGGCTTACGGAAGTGGCTTGGCTTGGACAAGTACAGCAAGAATTATGCTGAGGTGGCAAGGCCACTGTCCAATCTCCTTAAGAA
GGATGTGGACTGGTGTTGGGACACCGGGCATCAAGCGGCTTTTGAAGCCATTAAGGAGAGCCTCCTTCAGGCGCCGATCCTGGCGCTGCCAGATCCCGAT
CGTCCTTTCAGTGTCGTCTGTGACGCGTCGGACTTTGCCATCGGCAGTGCTTTGTTGCAAGCAGACGCTGAAGGGCGTGAACGCGTGGTCGCGTTTGAAT
CTCGCCAGCTTAAGGCTGCTGAGAAGAACTATCCAGTTCATGACAAAGAGCTACTTGCAATGAAGTATGCGCTCGTCAAATTCAGGGTTCCCCTGTTAGG