Description :
From Genome Similarity Track
Location :
Scaffold_2008:1- 1486
Transcript NameFunction/comments
Phypl_g14538hypothetical protein

Sequence
1485 bases(100 bases per row)
TTGAATTCTGCAGACCCCGCCACTTGCCCATTCTTTCAGTTCCCCAGGGAGGTTTGGTCTGTTTAGGCCATTCTAATGAGGTCTTAGCCGCTCTGATCGG
CCTTATTTTGATGTTGTACGAGGTTTTgaggctctgagcacgtcagactttcaggatttgagtgccatgacatccgtccttAAAGTACCGAAAAATGTCA
ATTAATGACCGTGTATTTTTGGTAGCAGTAACATCGTCTGACCCTGATTGGACGAGATCGAATACCGCATAGGCTTAGGCAAAGGCGAACGCAGCGAGTG
TTTGGATACCGTGTGCGTTGTGTTGGGGACAACACCGATGGAAGAAGACCAGATCCACAAAGATTCAAAAGCTGAGAATGGACGTCGAACTAGCTGTTAT
AGCCGCCATCGGGACATGCGATTAGGCCGTCGCTATCACACTAGCGGCGGTCGCAAAGAAGGAGAAGTCGAGCGTGCTCACGCTACCTGCTCGCAATTTT
AACGCCATGCTAGCCGATCCCTGCTACGACAAGTGGTTTCAAGACAATCTGCGCTTCACTCAAGCAAGTTTCCGCACTTTGTGCACACTTCTGCGTCCTC
TCCGAGCTACTACTCCTGCTGCGTACGTTGAACACTCTTTCGAAACTCGTGTAGCAGCGATGCTCTTTTACCTGGCGTCGACGGGCGGCTTTCGCGAGAC
AGCGAATATGTTCGGCGTGTCTAAGAGCTGGGCTGTAACTGCTATCAACGAGCTGCTTACTGCTTTGGCAGATGACTATCGTCGATACATATATCTACCG
ACCCCACTGAAAGATTGGGGTACAATTCAGGCTGCGTTCGAGCTCCGAGGTGGGGTCCCTCTTGtgtgtgctgcagtcgacggaACGGTCATTGAGCTTG
CTCGCTTCGGCGATTACGAAGGCTGGTACTACCGCAAAGGGTCCCCAGCGGTCAACTTGCAAGCTGTTGTCGACACAAGGCAGCGTTTTATTTCATTTGA
TATGCGCCCTGGTTCCTGGAGTGACAAAAATATATGGACCGCATCGCACTTCGGACAGCACATCGATGAAATTCTTCCGCCTGGCGGGTTCGTTGTTGTA
GATAAAGGCTACACGCTGCCAAATGCTATATTGATTCCCTATGAGACGTATGATCATGATCTTGATCTCACGCGCCGCGAGTGAAAGTACAACTCCAATC
ACAGTAGAACACGGATTGTGGTCGAGTGCACATTTGCTACGCTGAAAAATCGATTCCGCATGCTACGAAGGCCATAAGAAGCAAAGACAGTGAGTaacat
ctcgtccacgatTGTAGCATGCATGGTACTACACAATATTGCAATGGACGTACAAGATACCACGCCGCTCCCAGACCCTACGACCACATTTGAGCACGCA
GTTAGAGATAGATCAGTTGTTGTATTATGTATGAAGTGATGCGTCGTACCTTCGGAAATGGCTGCAGCTGTTGTCAGTTTTTGTC