Description :
From Genome Similarity Track
Location :
Scaffold_2305:1- 1469
Transcript NameFunction/comments
Phymu_g14034reverse transcriptase

Sequence
1467 bases(100 bases per row)
GATTTTGGGTGGTGTCAATGACCGATCGAGCTCGCGCGATCTCGGCGTTCATCACCCCATTTGGTCTGTTCGAATGGAATCGCATGTCTTTTGGACTGAA
GAACGCTCCCCAGATCTACCAACGTCTTGTCGACAACGCCTTGTATGGATTCCTGAAGATCTCGCGATCAGGTGATTCAGAAAGCCTGGTCGATGGGTTC
GAGTCGGGGATCCCGGAAGATCCAGGTCGACCATCGGTGTTGGACCGTAGACCATACATCGATGACATCCTGATCGCTGCTGGATCGTGGGACCAGATGT
GCCAGAGAGTGGAAGATCTACTGAACGCCTGTGACAAGTGGAATCTGTCGATCAGCGTGGCGAAGAGTTTCTGGGGTATTAACAAGGTGGAATACCTCGG
ACATCGAGTGTCGATCGACGGCCTGGAGGCTAATCCAAAAGATCTGAAATCCTTGACCGACCTACCGCTTCCCGGATCTCTTCGATCGATGCAATCGTTC
TTGGGTAGCATCAACTACTACAGCGGACTCATAGAGGATTACGCAGTCTATGCCTCAGTACTGTATGAACTACGTGAAGTGGAGTTCGCAAAACTGGGGA
AACGACCCGAGTTACGGAGGATCATGGATCGGATGGACGCGATTACACGGGATCCCGATCAGTTGGAGCGCGAACTTGCCAGATCGCCGACAGGACAGGA
ACCGGAGCTCGATCAAGTCCCGAATCTAGACTTGGGGGGCGATCGATCTCGGATCTAGCATTGGAGACGTGGAGGCACGATGGGTCAAGGCTCACCAGGC
GTTCAGAGCCTTGAAACGTAAGATCTTGTCAACACCAATCTTGCGTCCCTTGAAGCGAGGCGGGGGAGCCTACAGAGCGATCGTGTGGAGTCTGCCCGGG
TAGAAGGTGATCAATGCTGGATCAAGCTATACCGAAAGTCTTACGTGAATGAGGCCGAATACAACGGTCTGTTGCTAGgtctggaactgctgaaCGACCT
CGACCGACGACGTTTGGTGATCTGTGGTGATTCCAACCTCGTGATCAGACAAGTCTGAGGTGAGATCGACCGCAAGGACCCGGGATTGGCGCtactgaag
cagaaggtccTTGATCGCCTGGAAAATCGGGGTGATCACGAGTTGGTGCATGTAAAGCGTGACTGGAATGGAAGCGCCGACAGCTTGGCAAgcgcagctc
ttcagcggCAAGACGGGATCGAGGTCAACAGAGATGCGGATCGACAGGATCTAGTCATCCTGAATCGACTGGGCGAGGTCCTTATACCCAAGATCAAAGA
TCCGGTGGTACGGGTTTCAGATGTAGCTACACGGGCTGCTACTCGTGCACGATTCAACACCGCTGTCCTCcaagaggagctggtcgaagaaATGCGAATC
GATCGGATCAGACGAGCGCAAGACGAGGAAGTATGGATCGCAGGAATGAAGAAGTATCTGATCGGGG