Description :
From Genome Similarity Track
Location :
Scaffold_3247:1- 1467
Transcript NameFunction/comments
Phyag_g13147hypothetical protein PHYSODRAFT_551426

Sequence
1466 bases(100 bases per row)
CTCCCGCCCTAAGCAAAGATGACTGCGACTGCACCTCGCCGATCTCCGTTCTACACGCTAGAGGATGCCAAGATCAGCTTCAACAtattctgctgcttct
gcggcATCGGGTCGCTGTCCATGCCTTCCAATTACGCTCGAGCGGGTCCGGTGTACGCGACCATCGCactgctgctcatggccTCCGTGAATATCTACTC
CACCATTGCTCTGTCCAAGGTCATCTATGCGGCACCACCGTCGGTCAAGACCTTCACGGATGTGGGCGCCTGGGTGTTCGGTACTCCTGGACGCTACGCC
GTCATGGTCTCGCAACTGCTGgtgtgtctgttgctgccgtgCGCCTTCCTGGTACTCGGTAGTACGTTGTTGGACGTGTTGTTCCCCGATTCGTTCAGCC
AGATCTTCTGGATGATCTTCATGGCGGTCACGGTTATCCCGGTGTGTATGATCCCGACCCTGAAGGAAGCATCTTCGGTTGCACTCGTGGGTTGCCTCGG
AACGATCATCGCCGATGTCGTCGGTGTGTCCATTCTGGAGTGGGAAATGCGTGGCCACCCGTCGATCCCGACGCCCGACGTCTCGCTGCACCAAGTGCTG
ACTGCTTTCGGTAACCTCGCTCTGGCCtacggtgctgctgttgtgatCCCCGACCTACAACGGCAACACTCGCAACCGGAACGGATGCCTCGTATCGTCA
TTGTCAGCATGGGACTTGgcaccgtcttcttcctggccaTCGCCATTGCCGGATACACCGCGGGAGGTTGTCAGCTTTCGGGTAacctgctcttctcggc
TGTGAACACGTCGGACCCGTACTCGGCATCGGCGCTAGGCTTCATCCCCAGCCGCGGCGCTGTCATCATGGCCTACCTCTTCATGCACGTACACATTGTG
ATCGCTTTCTCGACCATCACGATGCCTGCGTTCTTCATGGCGGAGCGGTTCCTGTTGGGTATGCACAAGGACCAACCTGTGGTCGACCAGGAGCAAGGCG
CCGGGATGCACGAGAAGCTTTCGTCCGTTGCGGGTGCCTCGCCTGTGGTTCCTGACATCGAGAGTAACTACGTCGCAGCATCGCCGAGTGTCCAGGGTGC
GGTCAAGTACGAAGACGAGTTCGCCGAGTACCGTGACAAGCTCAGCATGCTGCGTTACCTTACCCTGCGTCTCTGCATCCTCGCTCTACTAGTGGTGGCG
TCGGTCTTCCTGCGCGACCACTTCCTCGACCTCGTTGACTTCACGGGCGCCTCGGCCGTCACCGCTGGCAGTCTCGTGCTGCCTCTGATGTTCTACCTCA
AAATTTTCTGGAACAAGCTCCCGATGTACGAGCGGGTGGGGTCCATGGTGATCATCGTCGTGTGCTCGATTTTGGGCGTGTACGTGATGATCTACGCGGG
CAAGAACCTTTTCAACCCGGACTCGGACAGCGCTACCTTCCCGTACTGCTCGGAGGAGTACCAGAC