Description :
From Genome Similarity Track
Location :
Scaffold_1684:1- 1448
Transcript NameFunction/comments
Physo_145555hypothetical protein

Sequence
1447 bases(100 bases per row)
TCGACGAGTTCGTGTGCTCCATCGGCTTCCAGTGTCGGCCTTCGATCCGTGCCTCTACATTAAGGTGGTGGACGGTCACTGCGTGCTTGTACTGGTGTAC
GTGGATGACGTACTGATTACCAGGAGTTCGCCCGAGCTGATCGCACGCACGAAGACCGACCTGAAGACGCGCTTCGAGATGACCGACAGCGGCAAGTGCG
CGTTTGTTCTTGGGATCGAGTTGGTGGACGGCCCGGACGGCAGCGTGGCCATGTGCCAGCGGCGATACGTGGACGACATCCTGAAGCGCTTCGCCATGGA
CGAGTGCAAGGCCGTGGTGAGTCCGGTGGACATGAGCACTCGACTGGTTCCAAGCGACGCGGCGACCAAGGTGAACGCTCCGTTTCGCGAAGCTGTTGGT
GCTCTGATGCACCTGATGACCGCCACGCGCCCAGACATCGCGTACGCCGTTGGCTATGTATCGCGCTTCATGGAGAACCCCCAAGAGGAACACTGGGTTG
CGGTCAAGCGTATCTTTCGCTACCTGCAAGGCACCAAGACGCATGGGATCTGCTTCAAGCCGGGCGACAAGATCGACTTTCGTGGCTACTCGGACGCGGA
CTGGGCCGGCGACCTCGCCGACCGCAAGTCCACTTCAGGCTACACGTTCATGCTCATGAGTGCGCCTGTGAGCTGGGGAAGCAAGAAGCAATCAAGTGTG
TCGCTGTCCACGAGCGAAGCGGAGTACATCGCGCTCAGTCTGGCTATCCAAGAAGGCAAGTGGATTCATCGCCTGCTATGCGNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN