Description :
From Genome Similarity Track
Location :
Scaffold_4168:1- 1443
Sequence
1441 bases(100 bases per row)
AATCAGAAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCTCCACTTCACGAGGAGCTGTCGCTTGCCGCGACACCGTTGCTCCTGG
AGGATCCGCTCCACGTGGAAGTGGGCTTCTCCATTCCGGTCAAGCAGGGGCGGAGGTGCCCTCGTACGAGTACGAGTACTCGGCGCCTCCCGAAAGCCAC
TCTCGTCCGAGTGCTCCGACTGCGGGTCCGACACAGGACCCTGAGGTTGACCGCCTCCGTCAACGTGTTCTCGTGCTTGAGATTGCACTTGGCCTTGGGA
CTGGCGGTAATGCTGCCGGGAATCAGGGCGAGCTCGCTCGTCTTGCGGGCCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGA
TCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGATCCGACGGATCGAGGCTTTGTTGCCACGTCCGGAGCCGCCTGCGGCACACTCCCAG
ACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCGTATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCA
GCCTTGCCGTCCCGACCGAGGCTTGGGTGCCTGCTCCGACGCCCTCGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGGTCTGC
GAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCGACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACG
CACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTCCCAGTGTCTAGCGGTAGGTTCCTCGTGTC
TAGTAAACACTAAGTCACCCATCTCCAAAAATACTCAAGTTTTTCTCTCTGCGCTGTTTTGGTACGCAATTAATCTCTCTTTGTTTTAATCTGGGCCGCT
GCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTCCACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGG
AGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTTTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTA
GAACGGCGTGAACCCCGTGGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGCGCTGCCGCGCACAC
ACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGCAAA
GGGAACAGCGCTTTCCAAAACGCAGCAGTGACCCGCGGGTC