Description :
From Genome Similarity Track
Location :
Scaffold_3722:1- 1433
Transcript NameFunction/comments
Phyta_totarag15439reverse transcriptase

Sequence
1431 bases(100 bases per row)
CTATAGATGGTGCTCAGGGCCATCGAATCGATGATCACATCTTTTCCCGGTATCGGCGTCTGTGCCGGTATCGTCGCatcgttcagcttgttgtaCGCAT
GAACGATGCGCCAGCCGCCCTGTGGTTTCTTAACACAGAACGTCGGTGCACTGTGCGGGGACTTTGATTCCCGGACTTGACCTGCCTTGCGACGACTCTc
aaagaagtcgtcgatcgCCTTTACTTGCTctcgcggcagtggccactgccgcgtgACACAGTACTTCGTGCCCGGCACGAGATCAATCTCGTGCTGAATT
CCCTTGTCCTGCGGGAGCTCCGCAGGGATGTTGTCCGGGAGTACGTCTCTGTACTCTCGCAAAATATCGTAATAGGGACTCGACATGAGCGAGTCCCAGC
TCTGCTCTTcgaagcgctgcttcttcgtcttggcgctgagaGAGTCCTCACTCTCAGTGGTACTGCCAGCGAAGAGTTGCTTCAACTCTTCCGCctcgca
cttcaaccttTCCTTGTCTGAAAGGATGCagatctgctcgatgcgtCCATCGTGCAAGTCGCGCgcgaagcgcttccagctcatgaCTGGAAGCGGATGG
GATCCGCGGGCGCGCGTCATCAAGCCCGGCTTGATGCCAattcgcttcttcgtgcagcccgGCTGCACGTGAGCTCGCAAGCTTTTCTTGTGCTGGACGT
TTGCAACCGTCcgcactgctcgcagcgTCAGCTCCCGGAGCTgacgcgccttcgtcgcctcgacgccTTTCGGCAAAGATTTCCGTCGAATCGGATCCAA
TCAGATTCGCGTCAGCTCCCGGAGCTGactcgtcgccgtcacaAGGTTCCTTTGGGATCTTTCTTTAAATCTGAGTTTATCAGATTCTCAGTGTCGCTTC
CCAGAACCGACACACATTCACATCCAACGACTTCCGAAGTCGTTGGAGCTTTGCTCGTTCGCGCCTTGCGCGTAGAGACAGCAGCATTTAGCGCTGTCTC
TACTGGAAGGTCGCATGCACCTCGCGGTGCATGTGTTGCGCTGACAGGGCCATCGCTCGCTGTCGGCTGTCGCAACCGAAGCGTACAATTGtacgcttct
tccagtccatCTTTGGGTCATGCCGTGCAAGCCACggcatgcccagcaccaagtcgaacttgtcgtctaaATCCAAGACGATAAGGTCCTCAACAAACTT
CTTTTGTTGATACGAGAAGCGTACGCGTACGACACGCTTCTCAGTcttcacgacggcacctgttgccagtcgtacttccaatacacttcgaggtgtttgc
acctcctcgaactcaAGACTTGACAgactttgctgtcgaacaaAGTTGTTCGACGCACGTGAGTCTACCAAGGCACGAAGAGAGTCCGCTCTCTTCGAAg
acacgtccaggatgacaaGGTTTGGCTTGTC