Description :
From Genome Similarity Track
Location :
Scaffold_4180:1- 1431
Sequence
1430 bases(100 bases per row)
CCTTTGTGATCTACACAGACACGCGTCTTGAGACGGCGACTAACTCGCCTCACCTCTCCAAAGGATGGCGAGGTGGCTGTCCTTCCTCGCGGAATACAAC
TTCCGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCATCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGG
ATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCT
CTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGACCTCCTCTATTATCGGGTGGAGCCCACTGATTCTCCACGGGTGGTCGTACCC
AACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCACATGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTAAGG
CCTTCTGGTGGACCCACATGTATAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACT
ACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGGAATTTTGGTG
TTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCT
ATCACGGTCTCCCAGAGACGATTGTCTCGGATCGAGACCCGCGGTTCACTGCTGCGTTTTGATAAAAGGCTGTTCCCTTTACTGGGAACTCGTCTGCAGA
TGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTACGCGGCAGCACCACGTAC
GTGGTTGACGCAGCTTCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTAAACGGCTTCTGCCACCCC
AGAGTGCCTCTCACTCTTCGAGGAGACACTGACTCTTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCAG
TTTCGCTGCGGAAACAGGTGGAATCCTTTATGGATACGAAGCTGAACATTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAAGATAAACAAAAGGA
GTACTCAGACAAACAAGGAAGAGGAAACTTAAGTATATTTGAGGTTGGGGACTTAGTGTTGCTAGACACGAGGAACCTACCTCTAGACACTGTTAGCTCT
GTCGGCAGCAACAAACTGAAGCACCGCTTC