Description :
From Genome Similarity Track
Location :
Scaffold_3743:1- 1419
Sequence
1417 bases(100 bases per row)
TCACTTTGCGCGtgagtgcacagcacctgTGCACGGGCAGAGAGGCCAACGTGGAGGTGCAGGGCATCGCCGCGATCAATCTAAAAACGCGCGGAACCAG
TAGGCGCGGGGCGCCCTACTGGTAAAGCAATCACGCGTGCCAACATTGGACACGCGTCAATGAGGACTGCAGTCCCCAGTGAGAGGCAATCTCACTGCAA
CAGGCGAGATGGCAAGCCAAACTttgtcatcctggacgtgacGTCGAAGAGAGCGGACTCTCTTCGTGCCTTGGTAGACTCAGGTGCGTCGAACAACTtt
gttcgacagcaaagtcTATCAAGCCttgacttcgaggaggtgcaaaCACCTCAAAGTATattggaagtacgactggcAACTGGTGCCGTCATGAAGACTG
AGAAGCGTGTCGTACGCGTACGCTTCTCATATCAACAAAAGGAATTGGTTGAAGATCCTATCGGCTTAGATTTAGACGACAAGGTCGACTTGGTACTTGG
CATGCCGTGCCTTGCACGGCACGACCCAAAGCGagactggaagaagcgtaCAATTGTACACTTCGGTTGCGACCGCGCGACAGTGAGCGATGGTCCTGTC
AGCACATTACACCACAAGGTGCATGCGACCTTCCAGTATAAAAAGCGCTAACCGCTGCTGTAGCGACGGGCGGGGCGGGAATGAGCAAATCTCCGATGGT
TTCGGAAGTCGTTGGAAGTGAATATGTGTCGATTCTGAGAAGCTACACTGAGAATCTGGTAAGACCATATTTAGAGGATGATTCCGCCACAAAGGAACAT
TGTAGTCAGCTGACGCGAAGCTGAATGGATCAGATTGGGCAGGAAATTCGCCGAAAGGCGTCGAGGTGACGAAGGCGCGTCAACTCAGGGAGTTGACGCT
GCGAGTTGTGCGGACGGTTGCAAACAACCAACACCAGAACATCTTGCGAGCTCATGCAGGGCTGCGGATGTACATCAAGCTAGGCTTGATGAcgcgcaag
ctgaagaagctgcgcgatTCTCGGTCCGGGACCGAGACGCTAAGCAAGATGTCTGCCGGGCAGACATCAAGTCCGACGTCAAGCGTCGATCCATTGAATG
GCTTGACGCAGACCAGTACTAGGCTACAGTACAGGAGTATGCCACTTGAAAATCCTCCGACGAGTGCGTCGGAGTTGACATCGCTTCCGGtcatgagctg
gaagagtCTCGCGCGTGACTTGCACGATGGACGCATCGAGCCAGTGTGCATCCTTTCAGACAAGGAAAGGTTGAAGTGCGGGGCGGAAGAGTTGAGGCAA
CTCTTCGCTGACAGTACCACTGAGAGTGACGACACTCTTAGtaccaagacgaagaaagagcgcttcgaagagcagagttgggactcgctcaagtcgagtc
CCTATTACGAAATTCTG