Description :
From Genome Similarity Track
Location :
Scaffold_1303:1- 1413
Sequence
1412 bases(100 bases per row)
TGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGCGATTCAGGTCAAGCTGGTCCGACAAGGATCTCGAGTTAGTGTATCGCCACCAAGCTTTACGCGACT
TCCTGCATCAAGATCCTGTAATGCAGATCCTGGGTCCACGACAGATCGAAGCTCCAAGGGAACCGGTGAGAGCACCAACGAAAACGGCGAACTAGTTGGC
GGCAGTCAAGGATCTATTACGTTTGCTTACGGAGTCAGGCATCGTAGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGACTTGGACCTCATAGTA
TCCGCGACGTGGGACCTCTTTGCCAGAGTTAAGTCCATCACCGGAGAAAGGTCGCGTACTATGGATCCAGTGTCGTCACCGAGGATCAGCCAAGCTGTGT
CCTCGAACTACGAATCCGCGGCGGAAGATGCGTCCGACACGTCGTCCGAGCCCCGACGCATGCCACTAGGACCCTCCGAAGCATCCATGCTGGAAGCGCG
GTCGAGGATCCGGGGACAGGAAGTCCCTGTGAACGTGAAGGCTCGGGATCCAGTACGCCCTACCCGTGATCTGATACAATCCAGCCAGGATCGAGCCAGA
TACGGCAAGGAGCTAGTGGAGTTATCGTCAGATCGGGCTCAAGGTAATCGCCGTACAGATCCTGACTCGCCAGTGGACCAGACGGCCTCAGGCTCTTCCG
ACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGGTTTCTGGCCGAACAGGGTATGAGAGCGCCCGTGCCACAAGCGCAAGTGCT
CCACGAACATGGAGCACGAGAGTTGAGATGGAAATTCGTGGAGGAAGACAACTCCCATGATGAGTTCGACCCAGATGCTCTGAGATGGCCCATCCCTTCG
TCGGCGGTGGTAGCAACAGCCGCAGCCGGGGCAGGTGGATCGTCCATGATCCAGAGGGTACGGATCTCAGCCATATCGGATCTGAAGGAGTTCACGGGCA
AGGATCAAGATGAGGGCCGAGCGAGAACATGGATCAGCCAAATCAAGTCGGCTTTCATGAGAGAACAAGCGTCGGATGCCGAGAAGTGTTTGACCTTTGC
GGATCTGGTAGAGGGGCCAGCCAGGAACTGGTATCGGCAGTTGGGCAGATCCACCAGGAACAAGTGACCAGATTTGCTGCGAAGCTTCCAGACCCAGTAC
TGTGGATTGGGAGTGTCGGTAGCACGACAATACTACCATGCTCGCCGCAGATCGGATGTATCCCCGCTAGAATACCTGCATCGATATAATGTGGCCGGTC
TACGAGCCAAGTTGAAGATTAAGGATGGGGGATCCAAGGTACTGCGGGAACACGTGGATCATTTCATCGAGACGTTAGGAGATGTTGATCTGGCCGACAG
GCTGACCCTGTT