Description :
From Genome Similarity Track
Location :
Scaffold_1262:1- 1399
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_1262-snap-gene-0.23'5'-cyclic nucleotide phosphodiesterase

Sequence
1398 bases(100 bases per row)
TCCCTCTCTCTCCCTGCCGCCTTTGTTGTTGGTGAGTCGTGATTCGAAATCCAAAGTTGCTGCCCCACGTCATATGACGCAATTGACTCGGCGGTATACA
AACTCCAAGCCAAGCGCAGGACATGGTCGCAAAGTACTCAGGTGTGGTCGGACAGGCACAAAAACCGGCCAAAACAACCTTCAACAACCCCACGGCTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATAGAAATAGGGAAATAAAGGGTAGAAAAAACGACCGACCGGTCCGAACCGGTTAAGTGACAGTGG
ACCGTACAGGCACCAGATGGCTTTCACATCGCATTTGGCGGAAGGAAACGCACCGACGGAATCGCGCAAACTATGCACAATAACCGGTTTTGAATCGGTA
AAACGTTACATAAACCGGTTTTATATCAGTACTAAACCGGCACTGACAAAATCGGTACTATATCGATTGCCTACTGAAACACAAATGACAAATGTTCTGT
AGCGCTAGCCCCTAGATGGGTACACTATGTAACCCTCGCATGAGTCACTACGTAATGCCATTTTTGCGTGGCATGGCGCCGCCGCTGACAGCTTCGTCGG
CTTCATCAGCTATTTATCACCCGGACGCCCTTTAGCGCGCAGTATGGACTCACGCGACACGGCGTTCGTGCCACTCGCGCAGCTCAAGACGCTCGTGCAG
GGACTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCAGCAGCGTATCCTGCTGC
TCAGAACGAACACGTTCGAGGTGGAGCACAAGCTCGCGCAGTACAAGATCGAGCACCGCCAGAGCATGATGTCGCCGCCGCGCTCGACCGTGCGGTTCAA
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGCGTCTCCGCATCACCCCATTGCGCAGTCACCTTCAAAGGCTGCGCTCAGTACCTCAGCNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGTATCTCAACTAGAAGACGTCGTGGCGTCCGTTAAGG
AGATCTCGTCCCAGGGTGACTTCGCCGACGTGATCGCGCGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACACTTGGCGTGCTGAACGAACGG
CGCAACATCGTCGAGATCTTCTCCGTCGTTCCAGCACCACTAGATGACAAAGAGCCGATAGCTCCGCTTACTGAAACACGGCTCGGCACTCAAGACAA