Description :
From Genome Similarity Track
Location :
Scaffold_3730:1- 1398
Transcript NameFunction/comments
Phypl_g16000pol protein

Sequence
1397 bases(100 bases per row)
CCTGGAGCACCTGCTCCACGTGGTAATGCAGCTCACCACCACGGTCGAGGAGGGTCGGTGGAGGCCTCGCTCGACTATGAGTACTAGTCTCCTGTGAGGA
GGGAGGCTCCGAgggctgcggctgcgggGCCGACAGACCAGGTTGTTGCGCTGCAACAAGAGGATATTCGTCTCCTCCGCGATCGAGTGTATGCTCTCGA
GATCGCGCTTGGTCTGGCCAGGCTGCTGCCCACTCCGGCAAACTCGGTGCTCTGGAGGGCTTACACCGCCACACCCAGACACTTGAGCGGGAGAATCATG
ATCGCCTTGAGCGGGTCGATGACGTGCTCTGACCTCTGAGGTCGAGGACCTGCGGCGTCAAATACATGACTTCCAGCCCCAGGTCTGTGGCCGAGCACCT
TACCGGGAGGCTCAGCCGTACGCGTACTCCCAGCCGTACCAATATGGCTCGCACGGCGACTCGGCACACGCGGCTCCAGCGTATGCGCCACGGCCTTACG
GTCCGTGGGACTATCCGATCGCTTATCAGGGGCCACATGTGCCTGAGACTTAGTCTCGCTtcgaggaggtggccgagcCTGGTGGCTACCCGCCACTTCC
TGCGGGTCGTGGTACCGCTTCAGACGACTCACATAAAATGTCGGGTGGGCCGCCATCGACTTAGGCAAGTCGATGGTGTAGACAGCTCCGTGCATACTCA
GGACCGCGAAGGGTCCAATGAAcctgtgcttcagcttgttACTGCCGCCAGCACTTACAGTGTTCATGGGTAGGTTCCTCGTGTCTAGGAGTACTAAGTC
TTCCACATTAAACACGTTTAAGTTTCCTCTTCCACTTCGGTCAGAGTACTCCTTTTGCCTGTCCTGGGCCGACGCCATTGCGTCTCTAACCCAGCTGATG
ACATTCAGCCTGTCGTTGACAAACGACGTCAATTGCTTGCGCAGTGCGGCTGGTCTCACCTCAGGGACTGGGGAGGATAGATCTTCCCTAGCCTCTCCCC
CACTTACGACCGAAGCATCGGTGGCCCCACGTAAAGTGAGCGGCACCTGGGGATGACGCATCCCATTCAAGTAGAACGGAGTGAATCCAGTTGACGCGTG
CACCGCGTTGTTGAGCGCAAACTCAACCGTGGGCAGCCGTGCTGCCCACGTGCTTGGCACCTCAGCACAGACACTGCGCAGCGTGTCTTCAAGGGCGAGG
TTAACGCGCTCCGTCCGACCGTCCGTCTGAAGATGGTCAGCAGTTGACATAAGCAACTTCGTTCCCAGTAGCTGGAACAGCGTTTTCCAAAACGCAGCGG
TAAACCGCGGGTCTTGATCAGAGACAATGGTCTCCGAAAGACTATGATAGAGGAACACGCAATCCAGGAACAGCCTCGCGGCTTGTTCCCCGGTGAG