Description :
From Genome Similarity Track
Location :
Scaffold_2368:1- 1378
Transcript NameFunction/comments
Phymu_g14070hypothetical protein PHYSODRAFT_511466

Sequence
1377 bases(100 bases per row)
AGCACTTCCTCTAGATCTTCGGCATCAGTGAGACGGAGCAATGTCAGCCGATCGGCGAGATCCGGATCTCCGAGAGTTTCGACGAAGTGGTCGACATGTT
CACGTCGCGTCTTGGCGTCGCCATCCTTTATCTTGAGCTTGGCTCGTAAGGCAGCTACGTTCAGCCGGTAGAGGTACTCTAGTGGTGACTCCTCGGATCT
TTTACGTGCGTGGTAATATTGCCACGCTACCGATACTCCCAATCCACAGTACTGTGTCCGGAAGCTTCGCAGTAGATCGCCCCACTTATTTCGCGTGGAT
CGTCCTAACGGACGGTGCCAATTCTTGGCCGGTCCCACAAGCAGATCCGCGAAGGTCAAGCActtctcttcatccgaggCTTGGTCCCGCTGGAAGGCTG
ATTTGACCTTCCCGATCCAGGATCTGGCTCGATCTTCGTCCAGATCCTTTCCGGAGAACTCCTTCAGATCCGAGATCGCCGAGATCCGCACTCCCTGGAT
CAAGGACGATCCTCCTTGGCCGACTGCGGCTGTAGCCACCACCGCACGTCCCGAGCTCGGGATCTCCAGGTCATCGGGATCATACTCCCAATGACGATCC
GGATCTCCAACCGACTCCATATCTACGTCTTGTGTTCCAGGATACCTCGGCAGATCAGAGGCACGAGGGGCAGCGatcacttgctgctccttcagaAAGC
AGGCTCATCGCGGACTGGAAGTACGCCTCCAGCTTGCCGGTTGACTCCGTAGACGTCGGAGCAGTCGGGATCTGATCTGACGGCGGTGTCCGATCGGTGG
TTCGCTTCGGcgaagatctggatctccgATCCGGCTGAGGATCTGGATCCGGAGCCTTCACGCGTGATCTGAGCAGTTTGGCCCCAGAGGGACCCAACGG
TATTCGTCGCGGGCCACGAGAGCTATCCGAGTCGGGATCGGATGTAGCGGACGCATAATGCGACGATCCCGTCTGGTACTCCGGATCCTGCGTTCGATGG
CGTTCTCCGACTAAGGTCCTAAGAGTCTTGAAGAGATCTTGGATCGCGGTCTGGATCGCCCCCAGGCCCAAGTCGAACAGGGTGCCTGGATCAAACGCTC
CGGCCACCAGACCTGCTTCGCGAAGCACCAGGCGGTCAGTCACCGCAGGCGGATACGACACGGGTCCTCTAAGATCCCCGATCTGGCGGACTTGTATTGT
CGTCAGCACCGGATCCTGGATCAGGATCTCGCTGAGCACCTTCTGGTGGTACGCCAGCTCGAGATCTCCCTTCGTAGGCGTAGATCTTGATCTACCCGAA
TCTTCTCCTTCCGATTCGGGTGCTTTCAGTTTTGTCCGTGtggccttgatcttcttcttctttgtagATCTTGGGGT