Description :
From Genome Similarity Track
Location :
Scaffold_4218:1- 1330
Sequence
1329 bases(100 bases per row)
CTCGTGCCCGGCACAAAATATTGTGTCACGAGGCAATGGCCTCTTCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAG
GCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGACTTTCTGCGTTCGGAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAA
CAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGAATGTGTTGTTCAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGAC
GGATACTACCAAATCCTGATGCGAGAGAGCGACATCCCGCTCACCGCGGTAAATACTCCAAGCGGCATGCTTTGGGGGTGGCTCGTCATGCCGCAGGGCT
TGTCTAACGCCCCGGCGACGCTCAGTCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTGCGACGACATATTCGTCCATAG
CCGTGCCGAGGGAGGCAAGACGGCCATGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTAATGCGAGCGAACAAGCTCTACGCCAACATCGACA
AGTGCGTTTTCGCGTCACCAGAGATTAAAGCTCTCGGCTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCAGACAAGGTCAAAGCCATAGCAGCATGG
CCAACGCCCCGATCCCAAAAGGATCTTCGAAAGTGGTTGGGCTTGGCCAACTACCTCCACAAGTACAGTCTCCTTAAGAAGGACGTCGACTGGCGCTGGG
AGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGTCCTGACCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTG
CGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGCCGACACGGCTGGACACGAACGAGTCATCTCGTTCCAGTCCAGGCAGCTCAAAGCCGCC
GAACGGAGCTACCCTGTCCACGACAAGGAGCTTCTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTAGGCCCTTCGTGATCT
ACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCGCGGAGTACAACTTCCGCGT
CGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCACTCTCGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATAT
GATCGGATACGCATGGCGTATCGAGGGGA