Description :
From Genome Similarity Track
Location :
Scaffold_3725:1- 1323
Sequence
1321 bases(100 bases per row)
CTACGCGTTTGGAATGTGCATCTTGCAATTGATTGCTGAGTCTTCACCACATGGGAATCGACGGCATGAGGATCAGAATTGGGTTGAATCACAACGGCAA
AATACCGAGACTGCTCACTGGCAGCTTGTCGGCAAAATGACCAAGACAGAACCAAAAGATCGAGTGAAAATAACATACGTTGCCAAAAAGCTTGAGCAAC
TTGCTACCGAAGAGCACGCCGAATTTCGAGCAAGGAGTGCTTCTTCCGAATATTGCCAAGAAGTGCAGATCGACCGAGGTGTTGATATGGTAAGTCTGCG
TCACTGACCTATTCTGTTGGCGAATAGTTTATTTTCTAACGCTCGTCCTCGTTACAGTCACAACACGTTGACGTTCGAGCGCATATGATCCCACAGATCG
TGAAAACCGTCCCCAAAGCACTTGATTACCTGCACGAGAAGTGCAAAAAGTGGTCCAAAATTGAACGCATGATCCAAGATGTGCTGGCACGGTTGGATGA
TCTGTACTCGCAACTCGAAAAGATGGAGCATTGTCCAAGGTGGCAGGCAGATGAATTTGGGAGCATTGTGTCTCAGTTTTCCAATTGTCTAAAGCCAGCC
ATATCGCCAAGCTCGGTGGATAAAGTTGTTCGAAGTCTGAAAGTTGCGACGCTGCATCAAACTTTTCACAACAGCTTGGATTTTTATCTAAAGGAGACAA
ATACCTTCACGCGAGGCCCGATTCACAAATGGAAGCACAAGTATAAAGACGATTTGCGCGAGTCGAGCACGTGTGCGACTGCCTCAACAACCGATTCAGA
AGCTTCCACCAACCACATCGATACTGTGAGGCTCGTTGAATACTGCGCCCGTCCAGATGGATCGGCGCCGTACTCTATTGCTCAGTCGTTTATTTCGATT
CCGCCTGCTTCGTTGAAACCATTGTGGTACTTGCCGCTAAGTGAACTCAGATACAACGCTAACGACCGTATTGGAGAAGGATCGTTTGGAGTGGTGTTAA
AAGGATTTTGGCTGGGCTCTCCAATTGTTCTCAAGTTTTTGGGCTACGAAGGTGATAAAGACTGCATCAGCACGAAGCTCTTCTTGCACGAGGTTCAAAT
TTGGTCTCAGCTGAATCATCCTCACATTCTCAAGTTTTTCGGCGCATGCCATGTTCAAAAGCGCTACATTGTGTGCGAGTACGCTCCAAATGGTACATTG
AGAGAGTATTTGAAGCTCAAAGAAAACAAGGACTTGGTATGGGAGAAGCTCTACGAAGCCGCGCTTGGGCTGCGCTATTTGCACAAATGCAACATCGTCC
ACAACGATCTCAAGTGTGACA