Description :
From Genome Similarity Track
Location :
Scaffold_3553:1- 1314
Transcript NameFunction/comments
Phyta_totarag15355hypothetical protein

Sequence
1313 bases(100 bases per row)
CCCTTGTGGGCCCTGTACGCTCTCTCCGACTTCTTTGAACTTCTGCTGTTGTGCAGGTTCTTTCCTGAATGTTTGTGCCACCTGTGGGACCGGGATAACG
AGATTTTATCTTGAGATCGTGAGATCGCGGGATCGAGATCACTCGCCCGCCAAAGTCGATACccatcaacttgattgaCTCGGTGAGGGTTGAACTGGcg
ttctcttcttggtcactctCATGGGTGTCACGCTTTCTAAGATTGACTTCTGTCGATCTAGATTGACAAAATAAGATCCACTTGATTTCTCTTGGTCCAC
TTCAGCACATCAGCAACATCTTCAGTACCTGCCACTCGTTGGACGTCAATCTGCTACAATTCAATGCACTAGTGCACAAAGTGATGTCGTACATCAATGT
GCTTCGTCCTGCTGTGGAATTCAGGATTCTTGGCCAGCTACTTTGCACTTTCATTGTCAAAAACACTTGTGGGGGTTTACTCTGTTTTACCTTTCGCTCC
TTGAGCATCTGGCGTGGGTGAATCACCTCCTGAACCTACAAGCTAAGTGCCATGTATTCTGCTTCGGTCGAGTGCAGCCCAACAGTTTTCTCAACTTGAC
TGCTCCGTAACATGGTGCTGCCATAGAACTGAGTTAAGTAACCCGCAACAGACTTTCGATAATCTTTTCGGTTTGCAAAGTCTGCATCGGCGTAAGCGTC
TAGATTTCCATTGAGCTTCTTATTTGCCCATCCGATCCCACCAAGCTTTAAGCCCCAAGCGAGTGTCTCCTTTAGGTAACGAAGACCTCGTTTGGCTCCA
CGCCAATGCAACATGCCAGGATTCTCCAGAAATTGACTGCACTCATGAACTAGATACGCTAAGTCCGGACGCGTTCCAAGCATCAAGTACATCAAACTTC
CGAGCACAGATCGGTATAGTTTAGCGTGCATCAGCGCTTTCTCCTCTGCATTCGTCGGACACATCGTCTTAGTCAATTTCAGATCAGGAGCACACGGGGT
CTTGCACCCATTGCAATCGCTCATTCCAAAACGAGATAACACCGACATCGTATACTTGCGTTGGCTAATGGACACAGTTCGATCACGGCGATTGCGCGTG
ATTTCCCAACTGAGAATGTAGTGCAGCTCACCAAGATCTTTCATAGAAAAACGAGCTTTCAACATGTCGTtcgactgctgcacgaggtTCACGTAAGGAG
CGAACAAAATCAAAGCATCCACGTAGATCGGGATGAACACTAACCAGCCATCAATGACCTTCAGGGCCACACACGGTTCACAGTTTAGTAATGATCTTTC
AAATGGGCCTTGA