Description :
From Genome Similarity Track
Location :
Scaffold_814:1- 1311
Sequence
1310 bases(100 bases per row)
CACCGAATTCTCTCGCAGATACAGAGCCAGGTTGCTTTCATCGTGTCGCTGCAAAACGGTGGCTGAACCTGTTCCCATCCGAACGAATTCTGCTGGCCGT
CATGAAACGCGGCAATGAGATTCCGTTCGGACACGGAAAACTGGTAGACCAAGACTCGCCTCCGGGACTTATCGACGGCGCACATGCAAGTATCAGACGT
GTCGGTTTCGATCGTGACGTCGCGTGGCGGGTGCGCCCTGAAGTATGCCAGCGGAACCCCGTTCAGGACCGGGTTTTGAAGTATCAAGGTCCACCAGCGT
AGATCCTCTTTCATATCGGAGTCAACAGTGATTGATGACCAGCGACTGAGATGCCGTTCCTTGCGCCGAAGACATTGTAGAAACGGCCGAGCGGAGTGGA
CACAGGCTGCGACGTGGCGGAGAGATCCCATAAGGGATCGAAACTGCGTATAGGTCATCGTATCCGCCTAGTGCGCGTCGTGAACGGCAATGGATGCTTT
CGTAATTTTGTCAGATGGCATTGACACAGAGGCGGCCTTGGTGTCGAACACCAGACCGAGGTCCATATGACGCGTGTTCCGCCCGGTGAATTTGTCATTG
TTCACGGCGGCTGGACCCAGTACTGACATCATAGCGGAGCGAAGAGATTGCTCAACGTCGGCGCAATTTGTACCCCTATCGGCCACCACACACACATGAT
CATCCACCCAGAAATAGTTATAGAACCCATCCGGGTAGTCCGCATTGCCAGTATTCCCGTGGATGTGTGCGATGGATCCACCGGCCACGTCGTAGTGCCC
GGGCGACCCTGCCCAGCCGAATCCTGCTGAGAGGTCGATCACCCAGGCATTTTCGGATGGGATTGAGCCGGCAAACGAATGAACAGAATTTCTAGGTTGC
GGAAGGCTGCGGCCACATCACCAAGCATAAGCTTGATGTCATCGACTGGGAACCGGTCTGGTTGTTCCAATATTTCTTTGGCTATTGGAATCACAATGGA
CGTATTCCGCCGTTGGTATGTCGGCCTGGACGTTGAGGTCATTGACAGAGCTACCGTCAGGGTAGGACAGGTCGTGGATGACATGACCAGAAGTGTCGGG
GTCCCCGTCGCCTTTGTCGACCACTCCAAACGGGCTGAGAAAGTTTTCTGGTCAAAACCTGCGTATGTCGAGGTCAACAACAATGCACCACCCCAGATCC
TGCTCTTTGCGAATGTTTTTGCGCAAAACGTTGGTGCGAGCGGCAGCGGATGGGTGGTTGGCTGGGCAGTGTGGTTAGGAAGGAAGCCGTTGCAACGTAG
TCACGTGGAT