Description :
From Genome Similarity Track
Location :
Scaffold_3884:1- 1305
Sequence
1303 bases(100 bases per row)
CTGATAGAACCCGTCTCTCAGATCCAGAGCACTATAGATTGTGCTCAGGGCCATCGAATCGATGATCACATCTTTTCGCGGTATCGGCGACTGTGCCGGT
ATCGTCGCATCGTTCGACTTATTTGTACGCATGAACGATGCGCCAGCCGCCCTGTAGTTTCTTAACAGAGAACATCGGTGCATTGTGCGGGGACTTTGAT
TCCCGCGCTTGACCTGACTTGCGGCGACTTTcaaagaagtcgtcgatagCTTTTACGTGTTCccgcggcagtggccactgccgcgtgGCGCAGTACTTCG
TGATGAATTCCCTTGTCCTGCGGGAGTTCCGCAGGGATGTCGTCCGGGAGTACGTCTCTGTACTCTCGTGGAATATCATAATAGGGACTCCACTTGAGCG
AGTTCCAACTCTGCTCTTCGAAGCGCTGCTTCCTTGTCTTGGCGCTGAGACTGTCTCGGTCCCGGATCGAgactcgcgctgcttcttctgcttgcgctgT
CTTTTATTCCTTTCGCGGAGCCCGGCTCCGCATATTTCTCGTCCGGGCCCAGCCGTGGACGGGTTCATGTTGTTGTCGCGGGCAGATTCTATCCGCAGGT
GTGCGTCATCGAGCCCGGCTTGATGAGCATTCGCTTCTTTGTGCAGCCCTGCTGCACGTGATCTTGCAAGCTTGTATTGTGCTGGACGTTGGCAACCGTC
CGCACTGCTCGTAGCGTCAACTCCCTGATCTGgcgcgccttcgtcgcctcgacgccTTTCGGCAAAGATTTCCGTCGAATCGGATCCAATCAGAATCGCG
TTAGCTCCTAGAGCTGACTCTGCGCAGTCACAAGGTTCCTTTGGGGCGGAAGCATCATTTAAATCTGAGGTTATCAGATTCTCAGTGTCGCTTCCCAGAA
CCGACACACATTCGCATCCAACGACTTCCGAAGTCGTCGGAGATTTCTTCATTCGCGCCTTGCGCGTCGATACAGCAGCGTTTAGCGCTGTATCTACTGG
ATGGTCGCATGCATCTTGCGATGCATGTGTTGCGCTGACAGGGCCATCACTCACTGTCGCGCTGTCGCAACCGAAGGGTACAATCGTACGCTCCTTCCGG
TCCATCTTTGGGTCATGCCATGCAAGCCACGGCATGGCTagcaccaagtcgaacttggcgtCTAAATCTAAGACGATAAGGTCTTCAACAAATTTCTTTT
GTTGAAACGAGAAGCGTACGCGAACAACACGCTTCTCGGTTTTCACGACGGCACCTGTTGAcagtcgtacttccaatACGCTTCGAGGTGTTTGCACCTC
CTC