Description :
From Genome Similarity Track
Location :
Scaffold_1634:1- 1303
Sequence
1302 bases(100 bases per row)
CCCCATTGCCAGCTTACGTGGTCGCTTCCCTTTTCTGCTCACAAACCAGACGATCACCATTGTTTGTGGTTGAGGTAAGCACCTCTGGTCTCCCTAACAT
CTGATTTCTTCTTCGTCTTATTTCACCACTTCAACCCGATTCCGTTTAGCTCGATCACGTCCAAATTCCTCCAACAATGCACCACAGNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTAAATTGCCTTCCCAAGTGTCCTCCGGTATTAGGGCTTGATCAA
AACCCACTCGTTTGGTTTCTTCTACCTCCAGCCGTGCAACANNNNNNNNNNAGGTAAACTTTGTACCAATTTTAGCTTAGCGATTTGCACGAGCGGGAGC
AGTCGGTATGCGGTCCCTTAAATTCAGCCGTACTGCAAGTTCCCCACACTTCTTGATCACCTGGGCCATGCCATATATGAGCCAGCTTCCTGGNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
TGTTGTGCTGATCAGCCCGGTCCTGAATAGCTTATTCTAGCCGGTCATTCACGGTGATCCGAGAACGTTTGTAATGTCGCTGTATATCATAGCTCTATGT
CCTCGGATCACGATCACGCGTTTTAGTGCATCCCAACGAAAGGGTTTCTTCCAANNNNNNNNNNNNNNTGAGATAAAACGGGGTGTCACTCCGGACTCGA
TCATGCGCTGTATTATTGTTGAAGGTCAATCGCTCGGCGTACTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTGCCATTTGCCGGAGGCAGATACGCCATTGTAACACGCTGATTTTGACCGGCAATAAGTTTGAATGCGCGAAAGAAATTCGA
CATGAACCCAGATTCGCGATCATGATGATTAGATTCGATCGCCCCAAATCACCGGAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCCTACCACGATCGTTTAGGTTGTCCTCGATGTGCTAGCCTTAGCGATCACGTAGCCGGAAAACNNNNNNNNNNTCAACCCAAAGATGCAATTCA
GT