Description :
From Genome Similarity Track
Location :
Scaffold_3056:1- 1284
Transcript NameFunction/comments
Phyin_T30-4PITG_22431Putative uncharacterized protein

Sequence
1283 bases(100 bases per row)
TTAGGGCAGGTTTCGACCGAGTCCCTCGAAGCCTTCCCGAACGTGGTCCTGAAAGATTTCCGTCGTGTCCCAGGGAAAGGTTGATTCTGGTCTTTCGAAG
TCGGGTCGAGTTGTTTCGATTGTTCGCGGCGGCTCTTCAGCTCTTGTTTTCCCCCATCGAGAGCGCCAGTGTAGGCTCGGAGTTTTGCCCGTTGTCGGCC
GCCAGACTCTCGACGCTTCTTGCGTGCCGTCGAAGCCGGTACAAGACTACCAACGCTGCCCCAGACCGCATGTCACGGGAGCTGCTGAAAGGCAGATTTG
AATGGCCATAAGCTCGAGCCACTTGTCCTTGTCGGCTGCGCACGGAGCTACACACTGAAAAAGCTTCTTATCGCGTGTCTCCATGGTGAAAGCGTGTTGA
TAGCGGTGGAATCCGGTCTTCCCGTCCCAGTCGCTGATGCACTTGATCTCGTGCACACTCGTAGGCTTCTCTGGGTGCGCGTCGTAGGTTTTCCGACTCT
TGTAGCTGCGCAACATGACACACTTGCGGTCGTGGGTGTCCAGCTCCCACGTGGCCACACAGTAACGATCGTGCATCACCGGCATTTTGGCCACGCGCTT
CTTGAGCATTCCCTCCATACTTACGGTAGTGGTGTCGGACGTGAGGCTACTGGTGATGCTGGCGCTGGCGCTGGCAGCGTGCGGATCGTCTAGGGAATTA
GCGTTCGATCGTTTGTGCTTGCGGTGCTTGCGCCTTCCTAGAAATCCGCGAATGCTGCGGGGTTCATCCATGAGCAGATGCGGCCAGGGAAGGGAGGAAA
CTGCGGCAACTAGGGGCGAGATCGACGGAAGCACAGCTTCGTGTCTTTGTCAGTGCGCTTGTCTTCGAAACCTGGGCACAACAATTACTGTACCGGTATA
GTTACTTTGTAACAAAAATCCGATGAACAATTGAGTACTGTTCCCATTTTGCTCGATCCAAACTGAAAAAAAAATCTATTATGCGATGCGGCTTGTCACG
CGATGCCTAGACGTAATACATGTACCGGTGAGATATGAACGCTAATACTGTAGCGGGTCGCTACTAGCGGCAGCTAGCTGGTTGCCAGTCAAAGCTTGAC
TCGACACAATAAGATGATTTCGCTTTACTGTTCATGAATTTGCAAACCGCTAAAATGGTCGTAAACATTCCTATTTCGGCGCAAATTGGGTCATATTGCC
TGGGTCACTACTTTCCTGCGGCGCATAGTGACGCACAACTTACGCATCCTCATATCGACGCGAACATGGATACGCCGAGGATG