Description :
From Genome Similarity Track
Location :
Scaffold_3353:1- 1255
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3353-snap-gene-0.0Amino Acid/Auxin Permease (AAAP) Family

Sequence
1254 bases(100 bases per row)
ACCTGATGGTTGGAGGGTAACCCGTGAGTGACGGTCTGTCTATTTGGTTGATCTACATTCATCCAATCCCCGGATAGGAGGAGTCGAGATCACTTTGCAC
ACACATCTGGTGTGCTCACACATGGGAGCACCCTTATGTAGCAGTGCTGTATCACGGTAGAATGAGGCTCCTCGAATGATGTAGCCCACTAGACCATGAC
GTTTGCGAAAACGCAAAAACAAACACTTGCAGTGAGTTGGGCATTTTTTGCATTTCAGGCCTTCAAAATTATCAGTGCTCAGTTGTCGATTTACTTCTTC
TTACAACGAAATTCCTTCTTCCAGCAGCCATTCGCAAACTCTCTCAACGCCGAGATGAGAAAGCTTGTCACGCTTGAAGACGCAAAAATTGCGTTTAACA
TCTTTTGTTGTGTCTACGGCATCGGTACCCTCGGCATGCCAGCTAACTTCTCCCGAGCTGGACCAGTGATCGCCACGTTCGCGTTGGTCTTTATGGCGTT
TGCCAACATCTACTCCGGTGTAGCCTGCTCCAAGGTCATGCTTGCGGCCCCGAACAGAGTCAAGACGTTTGGTGATCTCGGTGAATGGTGCATGGGCAAG
ACTGGACGGTACCTCGTCGTCACTTCGCAGATGGGTGTTTGTCTGTTGGTGCCGTGCGCGTTTTTGGTACTGGGCGGAACTCTGTTGCAGAGTCTCTTCC
CGGATACTTTTGAGTCGTCAACTTGGATTATCCTCATGGCGGTCGCCGTTATGCCAGTTTGCTTGACTCCAACTCTCAAGGAAGGAGCTGGAGCTGCATT
TGCTGGCTGCATGGGTACGCTTATCGCGGATGTCATCGGTGTTGCTGTCTTGCTGCACGACATGAGCGGTCATCCATCGGTACCAACGCCTGATATCTCG
TTCAAGCAAGTTGCGACGACGTTCGGCAATTTGTCGCTTGCTTATGGTGCTACGATTGTAATTCCTGCTCTGCAACGCCAGCACAGTGACCCGACGCGCA
TGCCTCGCNNNNNNNNNNGCTGACCTTCATCTCCGTGCTGTTCTTGGCGCTCGCTGGCTCGGGTTACTCTGCCNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCTCTTCACTATTTTCCCAGATCCAGTTACTGGATTAAGCAAACTGGGTTTTGCATCGAACAAGGGCATGGTCGTACT
GGCGTACTTGTGCATGCAGTTGCACATCACGATCGCTTTCGCCGTCATTGTCTC