Description :
From Genome Similarity Track
Location :
scaffold_2389:1- 1251
Transcript NameFunction/comments
Pl_100036pol protein

Sequence
1250 bases(100 bases per row)
CGAAGTTGACAATGTCAACGGCAGACTATCTGCAAACGGATGGCCAGATGGAGCGCGTGAATCGCGTTCTAGAAGACACGTCTTGCAGTGTCTGTGCGGA
GGCACCCCAGTCCTGCTCGGACCAGCTGCCTACGGTTGAGTTTGCACTCAACCATGTGGTACACATATCAACGAAGAACACCCTGTCCTTCTTGAATGAG
CTGTGACACTTTAGAGTGCAGCTAACCTTGCAAGGAAGCGGTAATGCTTCCATCGTAAGTGGGGGAGAGGCTCAGAAAGCTTTTTCTGATGTGAAATCGG
TAAAACGACAACTGTCAACTTTTGTTGACAATAGGCTGACGCTTATCAGCCGGGTTAGAGACGCAATGGCGTTAGCCCAGGACAAACAAAAGGAGTAGTC
AGACAAACAAAGTCGGGGAAATTTAAACGTGTTTAACGTTGGGGAGTTAGTGCTCCTAGATACTAAGAATCTACCCCTAAAGCCGTAGGGAGCAACAAGC
TGAAGCACCGCTTCATTGGACCCTTCGCGGTCCTCGGCAGGCATGGGGCCGCCTATACGATAGACTTGCCAAAGTCTATGGCGACCCACCCAACGTTCTG
GTAGCCTCAAGCGGCATCACGATCCACTGGGCTCTTCTCTTCAGAAGAAGGCAGAGGCCGTCCGTGAGTAGTTGAGCTCACCTCTTCAAACCGAGGTGGC
GTTCCGGAAGCAACCGGTACCGACGTCGCCGAAGCCGGCATGGGGAAAGCAGACTGATATCCCCGCGGCTCGAACGCCGAGTACACAGGAGTCCCATGCG
AAGGACCCCCGTAGGAGCCATACGCATAGGGTGGGTGATACCCATACCCCTGGGCCTCTCGAGAAGACCCTCGTCCGCGGACCTCCTGACTCAAATAGTC
GAGGTCGCGACGCAAGTCCTTCATGGCGGAAGCCGGAGCCCGACGGTCAACTCGACCATGGAGCTCCCGGGTCTCGCGCCCCAGTCCGTCCACATNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCGGCCCAAAGCCGAAGTCCGAGGGGACTGGGGCTGCGGAGCCTCGTACTCGTACTCGTGCGAGAGCTC
AACCTGCTCTCTTGGACCGGAAAGGTGAGTTCCACTTCCATGTGGAACGG