Description :
From Genome Similarity Track
Location :
Scaffold_3899:1- 1246
Transcript NameFunction/comments
Phypl_g16083putative polyprotein

Sequence
1245 bases(100 bases per row)
CCAGAATACCCGTGTGGCCCTGGTCGTCCGGAGGCAGCCCGAAGATGAAGTCCATGCTGACAGAGCGCCACGCATCCGTAGCGATCGGCAACGGATGCAG
CGGAGCCTGCGACGAGGGCGAAGGCTTGACGCGTTGGCAAGTTTCGCAGGATCGAACCCACTTTCGGATCCACTTGTACATGCGAGgccagaagaagtcg
cgGGATAGCGCAGCGAACGTCTTCTCGCAGCCGAGATGACCACCGACGGGGGCGTCGTGGAATTCGTGAACCagacgtcgtcatcggctgGGATGACGAC
GCGCGGCGAGTCAAAGGTGTCCGTCGTTTACGTCAGGAGCGGACCGTCAAGCTGGTAACGCTTGATGTGATCGCGAGTTGGGCCTgtcaacttcttcaag
gACACCGCGCTGGGATCTCGAAGGTGTGCGACGATGCCGGCGTAGATCGAATCATTGTCGTATGACTCAATGATCTGCTCGcggagcggcagcaacggca
cCGAGGTTGTTGTGTTGATGCCAAGCTGAACACAGCAGGCGCattcatcgtcttcctcatcAGCACCAAGAGCCTGATGACCGATATCGCGTCTCAGATC
ATAGTCTGGTCGGCGGGACAGCGCGTCCGCAAGGATATTATTCTTGCCGGGTTTGTAATGTACAACGACGTTGTACTCGGCGAAGAACGACAGCTAGCGG
GCCATGCGCTGCGAGAGATGCGGACACTTGATCGCAGTGCGCAGCGAAGCATGATCCGTGTAGATGGCGAACAGCTGCTCTCCGAGCAGATACACTCTGA
ATTTGATCAGCGCGTAGCGCATCGCGAGAAGCTCTTTGTCATGGACTGGATAATTCTTCTCAGCGGGCTTGACTTGTCGTGACTGGTAGCTCACGACGCG
TTCGCGGCCCTCATCATCAAACTGCATGAGAGCACACCCGATGGCAAAGTCACTCGCGTCGCAGACCACGTGAAACGGCTTTGAATCGTTTGGAAGGATC
AGGATCGGGGCCTCCGacaagctcttcttcacAGAGTCGAAGGCTGACTGGTGTTCCGGACGCCACGACCACGTGGTGtctttcttcagcagcgacgaca
gcggctggATCAGTCCGGCGTAGTTCTTCGTATACTTGTGAAGGTAATTCGACAGAGCCAGCcactggcgcagctccgtgggGTTCGTGGACGTTGGCCA
AGAACATATCGACGTGATCTTCTCCGGGTCGGCGCGGACACCGTC