Description :
From Genome Similarity Track
Location :
Scaffold_673:1- 1245
Sequence
1243 bases(100 bases per row)
GGAGACCGAACACAAAGTCCATGCTAACAGACGACCACGGCGCGGTAGCCACCTCGAGTGAACGGAGTGGAGCTTGTTTCGAATGCGAGGGCTTCACACG
CTGGCACGCTTCGCAAGAGCGCACCCATTTACGCACCCATTTGTGCATGTACGACCAATAGAAGTCTCGCGAGAGCGACGCGAGTGTCTTCTCGCGTCCG
AGATGACCGCTGCTCGGAGAGTCATGGAACTCGTGAATGAGACGAGCTCGAAGATCGTCATCCAGCGGGACGATGATACGTGGCGGGTCGTCACGATCAA
CGTGAAAAGTTAGTAGATCACCGTCAAGGACGTGTCGGTCGATGCAAGAACGGCTGCGCGTCGACAGGCGGCGCCGCGCCGAGTCAGAAGGGTTTCTCAG
GTATTGGATCATCTCTAGACACATCGCGTCGGACTCGTACGCGGCCACGATCGTATCTCGTAGGGAGCTTCTCGCCGTGACCTCCACCGCAGCGAGTTCC
TCGGCGGTGCATACAGCACATTCGTCATCGTCTTCATTGCCAACTGCATGGCGACCCGACTGCGCGTAATCTGGCCGACGCGACAGCGCGTCGGCGAGGA
TATTGGTCTTGCCAGGCTTGTAGTGCACGACAAAGTTATACTCGGAAAGAGAGAGAGCCATCGCGCCATGCGTTGGGACAAGTGTGGGCTCTTGGTCCCC
GTCCGTAACGAAGCGTGGTCGGTGTAGATGACGAAGGTCTGTTCGCCCAAGAGGTACACGCGAAACTTGATGAGTGCATAGCGCATCGCTAGGAGCTCCT
TATCGTGGACGGGGTAATTACGCTCCGCCGGCTTCAGCTGTCGCGACTGGTAGCTAACCACTCGCTCGCGCCCTTCGTCGTCGAATTGCATTGGGGCGCA
CCCGATGGCGTAGTCGCTTGCATCGTAGACTACATGGAACGGCTTCGATTGATCAGGGAGCATGAATACGGGCGCGGTGGATAAGCTCGTCTCCACCACG
TCGAACGCCGCCTGGTGCTCTGGACGCCACGACCACGTGGCGTCCGCCTTGAGAAGTTGTGATAGCGGTCGTATGGTCTCGGCGAAGTTCTTTGCGTAGT
GGTGGAGATACGTCGCGAGCCTCAGCCACTGTCTCAGCTGCTTCTGGTCTTGTGGCACCGACCAATCACAAATGGCCGCGATCTTCTCTGGGTCAGCACG
GACCCTTCCTTGCTGACATAGCTCCCGAGTACTGGGATCTCAG