Description :
From Genome Similarity Track
Location :
Scaffold_1919:1- 1245
Transcript NameFunction/comments
Phyin_T30-4PITG_22241Putative uncharacterized protein
Phyin_T30-4PITG_22242Putative uncharacterized protein

Sequence
1244 bases(100 bases per row)
TTAAGTGTCGTCTTGACCTCCGAGATACCTGAAAGCAACAGGTTACTGTAATGGGTATCCGTCACTTACACAACTGAGAAACACCAAGAATGGACATACC
TGACCCAGCAGCTACCGGTTCTCCAAACGACGTGACAGTCGCAGCAATTGCTACAAGTGCGAGGTTGAATGCCACGATGGTCCAGAACGTGGTGCCGAAG
AGCACGTGCTTGGCCAGCTCGTGGTGAATGGTATACTCGAGTAGGTGCTGCTTCAGTGACATTAGCAGCGTGGTGAAGTAAAGCATGAATACCGCCACTA
GCGCCGTAATGACACCGGTGACGAGTGTGAGGAACCAACGCGCGTAGATGGGTCGGTTCTTCTCCTGACCATTGCGGTACTTGTAGCCCATGCCCGATTT
ATTCACCACACTCTCGAACAGGTCTGCGTCAAGGATTTTTTCACAAGGTTAGTCCCGCAGTTTTGTACATGTACAATTCTCTGTATCGTGGCATTGTTGG
GCATCGCACCATAGTCTAGACTCTCGAGGTCGCCGCATTTCCACAGCATCTCTCTCTGCCTCCGCTTGTATCACTGTCTCTCGCCCGACGTTACAGCAAG
CTAGGCGGTGATATAATACAAGAGGAGTATGCGGTGAAGTGCAGGGGCTTCGTTGCTAGTGGCCGGAGGCAACGAGTGACGAGAATAAGCGGGGTTGCAT
GCAGGGAAATCTACCTGTCGCCATTGGGCGGAACATCCGTAGACAGGTTTTGGCCAATCGTAGACAGCTTTGAATAGTCCTAAAGTTGCCAGGCTATCGG
TATTAAATCGGTGAATACCGATTCGCTGCGAAAGTCCACCACCGCCCACTTCCCCTGAAATTGATAATGGCTATGAGCTCTAAAACCTCGGCTCCTCAAA
AGCTCGTCCGAGGCTTGCGTGCTATTAATACTACTCGTTGGAAGATTCCAAAATCATCCGTTTTAATGGATACACGCTAGATTATAATCCGTAACCAGGA
CAGATGCTGAAAGATTCAGAGCAAGTTTCATCGTCCTCAGAGCAACTTTGTTCAGCTGGTTTGGCCAAGTTTGTAGTGATCACCCTGAAACTCGAGCTCT
TCTTCACAGAATTCATGTTATCCTTGCTTCTGGTTCATGCTAAATAATTCACGTTTTCTGTGGCGTACGAAAATCTGGTCCGTACAGATGCTCCAGGTAG
AGCGTTCTTCTCGCTGGGCAGAGCACTTGGAAGTCGGCAAATGG