Description :
From Genome Similarity Track
Location :
Scaffold_3465:1- 1235
Transcript NameFunction/comments
Phyag_g13262pol protein

Sequence
1233 bases(100 bases per row)
CCCAGATCGCGACAGCCTTCGGGCAGTCTGCCTGGAGCCGCTCGTACGGCTCCCACGAGTTCTGCGACTCAGGGTACCCCCTCCATTTCACCCAGAGCTG
GCGCTTTCCACGAAGCCGCCGCTCCTGGAGTACCCGCTCCACGTGGTAGTGGAGCTCTCCGTTACGGTCGAGGAGAGCCGGCGGTGGCCTCGCACGACTA
CTCGTTCGAGCCCCTTGCGCAGGAGGCTCCGAGATCCTCGACGGGTTCTCAAGACCAGCTCgttgtggcgaggcggtgaccaaacccacgggaaagccaa
acagagtcgaccccgggaNCTGCCGAGTCTGGTCAGCCCAGTCCCCTCGTGGTCCTTCAGGATGAAGTGCGCTCACTTCACCGGGAGGTTGGTCGCCTCC
ATGGTCGTATTGACCGTCGTGCAGCGGTTGATGACCTGCATGCACTGCACCGTACGGTCCAGGCGCTGGCGGACTCCCAGTCCCAAGCGCCACGTCCGGA
GCCGCACCCGTATGCGTACTCCCAGCAGCCGTATCCTCACNTAGTGTCCAAGAGGACTAAATCACCCACATTAAACACGTTTAAGTTTCCTCGACCATGT
TTGTCAGAGTACTCCTTTTGCTTATCTTGTGCGTTGGCCATTGCATCTCTGACCCGGCTGATTACATTCAGCCTGTTGTCGACAAAAGCCGACAACTGTT
TCCGCAAGGAGGCTGGTCTCACGTCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTACAACTGAAGACACGGTGCCCCCACGCAAAGT
GAGCGGCACCAGGGGATGACGCAGACCGTTCAAGTAGAACGGCGTGAACCCCGTTGATGCGTGGACCGCATTGTTGAGTGCGNGTTGACATATCCAACCT
CGTTCCTAACAACCGGAACAGCGTTTGCCAAAACGCAGCGGTAAACCGAGGGTCTCTGTCCGACACAACGGACTCAGGGAGACCATGATAGCGGAATACG
CCATCCAGGAACAGCGCTGCGGCCTGTTCCCCTGTGACAGTGTCACGGACCGGAGCAAGGTGCACCATCTTGCTCAGGCGGCACACGAACACCAAAATGC
CGGTGTTGCCATGTCTGTCGGCCGGAAGGCCAAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAAAGGAGCCGA
AGCGTGGCCCGCAGGCTTAACACGCTGACATGT