Description :
From Genome Similarity Track
Location :
scaffold_267:1- 1234
Sequence
1233 bases(100 bases per row)
CCGGTTTATGAAAAAGAGCTTTTATCAATGAGGCATGTTTTGATTAAGTTCGTGTATACTTGGTTGAAGAGGAGCGGTTTGCGGTTTATACAGATCGTGC
CTCGCTGCGTACGGCATTAAGGACTTCTTTTTTATCGCAGAGATTGGCTTGAtggttttttttctttgcggGGCACAACTTTGTTGCACACTACAAGCAA
GACAAGACAAGACAAACATCTTAGGCGATGATTTGTCAGACTTCCGGAGTCTGAACCAAAGTTCAGGAGCGAATGCATGCACGAGACATGTCGACATTGC
AAAGATTTTCATAGATCAATTTGCAAGCAACGAATACAGTGCGCGAACAAACTGTCGAAAGGCAGAATGCTGATGAGACCTGTCTGGACTTCTTAAGGTA
CTTCATGGACATttccgacaaagcactgcaagaTCTCCCATCTCACACATAATCCCGTATTCACTGTTTCAAAGTACACAAAGGATTATTGTAGTATGCG
GTTGAATACAGAACAACAGGAGTTGCTGTTTCGAATGACGATGGTTTGCGTCATCGTCTCTTATATGAGTACCGTAACAGCCCTTCGGGTGGCAATCTCg
gacgtgagaaaacgtttcTCAATCTTTCCCGGTATTGCTCTTGGCCACACATGCATAAGCGGGTGCGCGAGTAAGTATATGAGGGCTTGTGTAATTTGCC
TTAGAGTGAAATTATCGAGTTCTTCTTAGGCTCCAATTCGATTGTTGTTAGTGTCAACTGACAGCTTGAAGTCTGTGAGTATGAACCTCATATTTGAATC
TCCGCGTGACACACATCGATACAGTGGCATCTGAACCGATTCAGCAAAATAGTTTATCTTGCGCCTGTTTTGAATACGATTTCAGCTGAGAATATAGTTA
AGGGATTTTAAGACGTTGTGTTTTGTTTACATGACGTTGTGTTTTGTTTACATGGTCTTCCCGTTAAGTCGTGTCTGTTCGTTTCACGTCGAAGTTTTAA
CAGCACTTTTAGACTATTGGGCACCAAAGAATCGTTAAAACTCgtccatgtcaacagcggcacaCCCCGAGACGAAGTGTCAAACATAGCTAGAGAACAA
ATACCTGAAGACGTACTGCGTAGTAACGCtatatcgctcaaagagtagAGTGAACTATTTACTCTCGCAGAGTTTGTCTTGAGCGACTCCACGTATGTCT
CGACAGGCTATTTGCCATTTTATGTGAATTATG