Description :
From Genome Similarity Track
Location :
Scaffold_3468:1- 1230
Transcript NameFunction/comments
Phyag_g13263phospholipase D-like protein

Sequence
1228 bases(100 bases per row)
TGGTGCCATCGTCGTGAGCAGCCGCCTCGAGCGCGTCGCACGCCTCCAGGAACGTCATGGCGTTCAGCTCATCGTACGTGAGTTTGGTCGCTTCCATGAA
CTTCTGGATACGGAAGTTGCGCGCCAGCTTGTTCACCGTGATGTTGTCGGGTgactgcaccagctccgtgtCCACGATGTTGATGCCGATCTCCGTGTCG
CTCGTCATGCTGCGGCGGTTCCAGTTGGCCGACCCCAGCGACacgtacacgtcgtcgatgatcACGAGCTTGCTGTGGATGTACAGCTCCTTGGACTCCT
TCGTCGAGTATAGATGGAACTTGTCCGGGAACGCCTTCTGAATTGGCGCCACCATGTCATACAAGTACTTGGCGTAGCCCGTGTAGCCAGCCTCAACCGT
GCGCTGCACGATGACAATGAGGCGTTCAATGCTGGGCATCATGTCCAAGAtggcctccagcagctccggcaCCAGGATGAAGTACTGGTCCTGGATAAAA
ATGTAGTTTTGCGCGTTGCGGATGGCCTTGATACGCGCGTGGAAGATGGACTGTTCGCCCTGCGGCGCGAAGCCGTAGTGGTCGTAGTCCGGGCTGAAGG
TGCGGCACAGCTGTACAGCGTGGGTGCCGTCGTCCGGGATGTCAAGAGGGATCTCTCCATCCTCCACAGGGGGCAAAGAGGAAAAGTCTGGGTTCTCAAA
GTCGAGGAGGTCATCCATCATGTCCAGCGACGGCTTGGGATCAGCGTTCCAGCGGTCCAGGAAGTTGCAGGCTACGTCCTTCGTGGCAGGACCCACGATA
CGGGCGTGAGCGTCCAGCCAGCCGTTCCACAGACACTTGATGCCGGTGCGTTCACGAAGGTCGGCCTGGTCGTGCTCCAGCGTATCCCAACGATCATTAG
TCAAGTCCACGCCACCGACGTAGGCAACGAGGTCACGGCCCTTGCGGACGATCACCGActtctggtggtgcgacGACGTGGCGTGCGGCAAACGGTCGTC
GTACACGAAGCGTGCAGGGCCGTACTGCTCCGGAGGCGGCAGAGCGTTGATGAGGTCGCGCACCTCGTGGTTCTGGGCGCGCTCCGTGATGTTGGACCAG
ACGAGCATGCGCCAATCAGCGCCGCGCttgacggcagcttcagccaaGTCGCAGAGCTTCGTGTCGGGCTCGTCCGGCTTAAAAGGCACGTTGCAGGTAC
CCCATCCGGTCAGGTACACGAGGTCTCC