Description :
From Genome Similarity Track
Location :
Scaffold_4372:1- 1228
Sequence
1227 bases(100 bases per row)
TTCGTACAGACGTACTTCGACGACATATTCGTTTATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGG
ACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGT
TCGGGCTGACCCAGACAAGGTCAAGGCCAAAGCAGCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAAACTACCTTCACAAGTACAGCGCTGGGTAC
GCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTC
TCCAAGAGGCCTCTGTCCTGGCTTCTGCCAGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCCCATCGGGTGTGCCATTGCTGC
AAGACGACACGCCTGGACAAGAACCGAGTCATCTCATTCCAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAACTACCTGTCCATGACAAGGAGCTCCTGGC
AATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTTCTGGGCTCTACGCCCTTTGTGATCTACACAGACCACGCGTCTTTGAAGACGGCGACTAACTC
GTCTCACCTCTCCCAACGGATGGCGAGAGGAGCTGTCCCTCTTCGCGGAATATAACTTCCGCGTCGAGTACAAAGCCGGGCAAGCTCAACGTGCTTGCGG
ACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGTGACAACGGATCTATATGATCGGATACGCATGACGTATCGGGACGATGAGGC
TGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGCGCTCACGGCTCTACCGATATGAGTTGAAG
GAGGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATG
ACGCGCCCTCCAGCGGCCACTTGGTCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGT
CAAGACATGTGAAACATGTCAGCGGGT