Description :
From Genome Similarity Track
Location :
Scaffold_3944:1- 1204
Transcript NameFunction/comments
Phypl_g16106reverse transcriptase

Sequence
1203 bases(100 bases per row)
CTTCGGGAAGcaactcctcgtcgaagtctACTCGCGTAGCCTCGGTCACATCTGGTGCCAATCGACGTTTCGGTCGGTCTGCAAATTCGTTCACGGCCTT
GAGTCGAGAGACATGCACCACCGGGTAAAGCCTATATCCAATCCGGTCGGGCAATTCCAActcctcgaccttcttcttcacgcggAATGGCCCGTGCCAT
CAGTGGGTCAGTTTCTTGGTCAATCCCGACTTTACGCGTTCCATGTACAACCAGACTCTGCCCCCTGGTTTGAAAAGAGATCTCGGTCTCACGTCGGGAG
CATCATCAGTTGCCCCTGTCTCCAATGGAATCTGACCCAACACCTCGTTCTCATCACCAGTAGTCGGTACCACCGCTCGTTCACGTCtcccaagcagctc
gttgtgTTCCTTCGCTCTCCGAGCTTTCTCGGTGGCCTGGTATTTCATAGCCCTTCTCCACGAAATCTCCTGCTGTCGGTTCACCTCTCGGCGCCACACC
AGTACATCGGCCTGGCCCCCAGAGCCTCGTTggagcgacgaagacattGCTCGAAGCGTGGACTGTGCATCCCAACCAGGAACGAGGCAAAACGGTTGTC
CTTCCTCGTTCCATTTTGTGAGTTGTTGATAGCGAAAATCAGTCGCTCGGCAATCTCGTCCCAGTCTTGCTGCAAGGGGTCTTCGGCATAGACGCGTACA
GACTGCATGACTGTCTTCACCGACCGTTCCTGCTGACCGTTCGCTTGCGGCCGATAGCTCAACGTTGCTCTCGACCGAGACTGCATCATTTCGGCGAAAG
CTTGGAAAACCTCGCTCATGAACCGTGGGTCACGGTCGTGGCGGATCAACGTCGGTGCCCCGAACCGTCGGTAGACAGACTCTTCGAAAGCTTGTGCCAC
CTTCAGTGCAGTCGTGTCGGACATCGCCTTGCCCATCATGAAACCGGTGAACGCACACTGAAACAGCAGTAGCGCCGTGTTGTCACTGCGATACTTTGGT
AACGGTATGACGAAGTCCATAGAGACAATTTGGAAAGGCCTTTCCGCCAGGATGTTCCCTGGTGAATAGCCTCGGAACTGCGGTCGACtcttgctcgagc
tgcaatCTGGGCAAGACATCACATGTCGTTCCACGTCTGCGTAGAGGCCGATCCAATAGTAATCATTGCTGACCCTGTGATAGGTCCGACCGATACCTTG
GTT