Description :
From Genome Similarity Track
Location :
Scaffold_3946:1- 1193
Sequence
1192 bases(100 bases per row)
TGGGATCGGCCCTGCTTCCAGTCTGAGCATCAGCGCGTGGCGCTGGCTATCTCCAGGCTTAGAGGTCGCGCTCGCGAATGGGCACTAACGTGCGGCACGT
CTGTTGACGCTGCATTTCCCACTTGGGATCAGCTGAAGCAACAGCTTTCGCGCGTGTTCGCGCCGCCTAATCAGGCGTACCGTATCCGGTCAAAGTTCCT
TGCTACCCGCCAGGGTAAGAAGGATTTATTGGACTATGTCCAAGAGTTGAGAACTCTTATCGCCGGAATGGCGGCGGACCCTCTTCCGGAACTGGTCAGC
GTGACCGTGTTCATGGAGGGACTTCGTGTGAGCGCAGCTCGGACGGAAGTGTTCCGTGTACACCCTAACTCTTTTGAAGAGGCGGTGGATGTGGCATTGA
ATGCCGAGCACAACTTCAGGTCGGCGCGACCTGGTTGGAGCGCTGGTAGCGCAAGCTCTTCGAGCGGTCTAGAGCCGATGGACCTCAGCTATGCTGAAGA
TGAAGAAGCGGAGCTTCTTGCTGCGGAGCAGCGCGCCGGCATCCGCCGATGCTTTGTGTGCAATAGCACTAAGCACTTGAGGGCCTATTGCCCTCTGCGC
AAGAAGCGCGAGGCTCCGGCGAGCCAACCCTCCGGGTCATCGCCGGGAAACGGCAACTCCCAGTAGGCGCGGGGCGGCCTACTGGGGAAGAACTGAGTTC
TGTTGTGCCTCGAAGAGGTAGAGGACAACGGGGCTCAGCCCCGAAGAGAGCTGAGCTCTCTTACGAGAAGAGTGTGTGCAAGCCGGGCTTGCTGGTCGTT
CAAGCGAACGTGAAGGGCTTTGCAAAGCCATGGAGAGTCTTGATTGACTCGGGAGCCTCGGGCAACTACGCCCGTCGCTCCACCCTGGAAGGGAGTCAGC
TGTATGCTGAGGCACTGGAAGTTCCAACGAGAGATACGATCTCTGTCCGTCTCGCGACGGGGACACTGGTAACTGTGTCGAAGGTCTCTGTCGACCTTGG
AGTGAAGTTTGAGAACTTCGATAGCGTGGAACGCTGTTTGGTCTTAGACCTGGATGCGAGGTATGACCTCATCCTTGGCATGGCATGGCTGGAACGCCAT
GAGCCATGGATCGACTGGAAGTCGAAAACGCTGGGTGCGTCGCACCCTGCTCCTAGTGGAGCTTTGGTGAGTCATGAACCCACCTCGGCTAG