Description :
From Genome Similarity Track
Location :
Scaffold_3963:1- 1186
Transcript NameFunction/comments
Phypl_g16117hypothetical protein

Sequence
1185 bases(100 bases per row)
CGGATACGGTCTCCAATCGTCAGGAGCCGTATCCCGTAGAACGACTAAAAAGCCACGGACTACTTACGAAGCTACTGTCGCTTCTGTTCCCAGATCGCGA
CAGCCTTCGGGCAGTCTGCCTGGAGCCGCTCGGTCGGCTCCCAAGAGTTCTGTGAATGAGGATAACCTCTCCACTTCACtagaagctggcgcttccCGTG
GTACCGCCTCTCGCGGACCACACACTCCACGTGGAAGTGGGGATTCCCGTCCCGGTCAAGCAGGACTGGAGGGGGTCTCTCACGACCACTCCCTCGAGTC
GCCTACTGCAGCGAGTGGCTCCGGACCTTCTCGGCCCCCGGACTCGGccctcgctctgctgcagcgggacCTTGATGCCCTCCAAGAGCATCTGTACGTT
GTGGAGATGGCGCTGGGCGTTGGCCCTGGTGGTCAAGCcacttctgcagctggacagCACAGCCGCTTGGACCGCCTGTGGAGCCACGTCGACTCCCAGC
ATCGTGCGATGCACGATCGGGTCGATCGCCGTGCTCGGGCTAAAGACCTGTCGCGTCTGTCGAGTCGAATCGACCAGGGTTCCGCGAACCGTGGGGCTTA
CCAACAGCCTTACGTGTACACCCAGTGGGGTGCACCGTACTTGCACGAGAGCTCCTCGTATGGAACTCAGGTGTACGCGTCTGCAGTGTACGACCAGCAG
GATTACCGCCACGGGTAtccgacgacgccttcgtcgtcctctgcTGGGCGCCCGGCGCCAGAGACTCAGTCTCATTTCGAGGAGGTACACTCGCCTCCTC
GTGGTCGGCTTCCACTTCCGGTGGAACAGCCTGACCCTGTGCGTGCGTCATGGTGTCACCCACCCGGCTGATGACATTCAGCCTGTCGCCCACAAAGGAC
GTCAATTGCTTGCGCAATGCGGTCGGTCTCACCTCTGAGACCTGGGAGGAAAGAGTTTTCTGAGCCTCTCCCTCACTTACGACCGAAGCCTCAGTGTCCC
CACGTAAAGTGAGCGGCACCTGGGGATGCCGCATCCCATTCAAATAGAATGGGGTGTATCCCGTTGACGCATGCACCGCGTTGTTGAGTGCAAACTCAAC
CATGGCCAGCCGTGCTGCCCACATGCTCGGCGCCTCAGCACAGACACTGCGCAGCGTGTCTCCAAGGACGCGGTTAACGCGTTCA