Description :
From Genome Similarity Track
Location :
Scaffold_1051:1- 11756
Transcript NameFunction/comments
Phyag_g9273hypothetical protein
Phyag_g9274hypothetical protein

Sequence
11754 bases(100 bases per row)
ACAAAGACCCCACCACAGGAGGTGGCAAGCACGGAAAGGAACAAGGAACACACACCCAAAGACAACCCCTCGATCGGCTTCCCCAAGAACCGATCAACCT
AAaccgacgactgcgtgaAGCATATCCGCGTAGTTGTCATCCCTACAATCCCAAGTACCGTCCATACGGCCCCAATCAGATCACAAGACACTTCGCGAAG
CACCAGAAGAGCGTAACCCGCCTAAACCaacgggtacacaaggtgagaAGGAGTTTAACGTCACACGGACAAGCGGAGCACCCCCTCCGTCAGTTGGTAG
TCTGGGCAACCGTTGGTGAGTTGAGATCACGTCACGCGATTTTCGTGaaacctgctccaccacaaTGGTGCGCGTGCCCGGATCTTCTGGTGACTTCGGA
TATCACCGCGAGTCATCCACAGAAGATGTCAAGATCAAGTTGGAACCGGGGATTGAGGCGTCGGCGGTGAGTGGATCGCCGCTGATGTCGTCGAACGAAT
CAGGATCCACCGAACGGCAGAGCGCTGGGAGGAGCTCTGCCGGGGTAAAGGAGGAAGGTCCAGCGATGGACCCAGAAGAAAAACCTCGACCTCCTCCCCA
GGTCCCTTCGGGGACCCCCGCGGATCATGCTGCGAAGCGTGATCCGCCGGATGAGAGTCCGTCGACCAACATCGATGGACCCTCACCCACCACCACACAC
CCACCCTCGCGTACAGCTAAGAAGAAATCGAAGCCGAAGGCTTcacggaagaagctgaaggcgcCGGACTCGGATGCTGATGATGGTGGTCTACCTCCGA
CAGACGGCCAACTAACGTGGACCTTCCTCTGCAAGGAGTTAGAGgacttcttggccaacgACCCCGTGATGAAGATTATCCGTCCGAAGTTGATCACGGA
CCTCTGCGGACCAGTGTCGTCACCAACCGAGATGACCAACAAGCTGGAAGCAGCCAAACTCGTCATGATGACGCTGAAAGAAGCAGGTCTGGTACCCGGA
GCGTTTGACGCGAATGAGCTGTTCAATCTGGGACTGAAAGAGATCAAGGAAGCAGCCTCAACCCTTGTCGAAAAGCTAGCGCCGCTGGTAGGCGTTGCCG
CCCCGGGAGAGATAgccaagatggagcagatgcGTAACCATGAGTATCAAACGGGATCGTCACAGTACGCATCGGTGACATCAGAAGTCGACTCTGGTAG
TTCGATCGACATGCAGCGCATGACGTTGGGACCTTCGGGAACCGCCATGCTGCAGGATCGGAAACGCGACGCGAGGCCGACGAGGGCCATGAACAGCCCG
CCGCTCTCCGTAAACCTGGTGCCCGGCACACATGGACCAGATCGCATGCAGGATTTCTTCGATGCCGCGATGGAACGTTTCCTTAAAGAACAGCGAGCAG
CGGGATCGGTGCCGACGCCTGACCGATCGAAGACGCCCGGAACACAGGATGTCGAGATGGAGTCCATCGGGTCACACCACGACCCGTCGGACGAGTACGA
CCCGGATGACCTGAGCTTGGACACACCACGCCCGGCCGCCATGGCAACCGCTGAAGCGCTGACAGGGAGCGCCTCCATGGTTCCTCGGATCAGGGTATCG
GCCATATCCGAGCTGAAGGAATTCGCAGGGAAAGACAATGACGAGGATCGCGCGAGAAGCTGGCTGAATAAAGTGAAGTCAGCCTACGTGCGCGATCAAG
CTCCAGACAAAGAGAAGTGCCTGGTTTTTGGCGATCTGCTCACGGGTCCGGCACGCAACTGGTACCAGCAGCTGAGTCGATCGACACGCAGCGATTGGAC
GCAACTGCTCGAGAAATTTCAGACGCAGTATTGTGGAAGAGGAGTATCTTTCGCGAAACAGTACTACCATGCCAGGAAGCGATCGGATGAATCACCTCTC
GAATATCTTCATCGGCTGATTGTAGCCGGCCTGCGAGCGAAGCTACCGGTCAAGGATGGACCGTTGGCCATGCGGCGCGAACATGTCGAACACTTCatcg
agacgctggatgaTCGCGATCTGGCCGATCAACTGGCGCTGTTGCGACTAACCGACGCCGAAGACTTGGAGGAAACGCTGCGGGCCCGTCAACGTACGAA
AGCACGACAGggcagagctgctgctggatcgaACAAGTTCCGACAGAAGACCCCGCCCACCGCTCCAGCTGCCCCCACCAAACCTACACGTGCAGTACGG
GCGATTCGTACGACGAACGATAGCAGCGGATCGGAGTCGGAGTCCAGTGGTTCGGAGTCCGAGGCAGAGGTTGCTCAAGTCTACCTGGTTGCTGCCACCA
ACGGCGTGAACCTTGGTGATGCGCGGGCGAATAGCCCAGATAACCCAGGATCAGCAGCTGGGCCCCCGAACGCGATCTCCCACGCCGGTCAGACTGGTCT
GCCAGCCAAACGGTGTTCCCACTGCGGATCACCTAAGCACGGTGACTTGggctgctggaagaggctGACCTGCCAAAAGTGCGGCCGGAAAGGACACCCG
TCCGATCAATGCCTGTTCGTCTGCCGTGCGTGTGGAGAACTGCACGAAACCGGAAAATGCCCCATGGAAGAGTTTTACAACTTGATCCGCATGTGGTACA
ACCCCAGCAAACATGCCGGGATGCTGCCCACAAACGCCGAGAAGATGTTAAACTAGGACGCTCGCCAGGTTGGAAACTGGTACGAGCCGAGCGTTCTGAG
CTCTGCATCTTCGCCTACGTCGGAAAGCACACGGACCTGAAGGTTAATAAGCCGATCGACAATACATTTGAACTGCATGGAGAACATACCTCTGCGATTG
CAAGCCTGCGAGTGGATGAGTATGTTCGATCGAGCGTGGCAATGGAGCTGGACTTGTTGCCGGGTGAATCGCGTGGCTACTGGAAATATCACGCCCCCGA
CAAGTGGTTCAAACAAGCCAAAGCGACCGCCAAGATCAACAACGAGAAGGCGACGTTACTCTTCGACTCTGGCGCCGAAGTCTCTATTGTGGACACCTCT
TTTGCTCGTAAAGTAGGCTGTACCATAGACGAAAGTCAGAGACAAGAATGCGTCGGAATTGGAGAAAGCGCATACATGACGACGGGACGTACCAAGATCA
AGATCACGCTGGCAGGATCTCTGGTGTACTACTTCGACGCTTGGGTTGGCTCGTTGTCAGGCCAGGAAGCAATCCTGGGTATGGACTTTATGGTTCCGGC
AGGAATCCGTCTCGACCTCGCGGACGGATCGCTGTGTCTCCCGGATGAGGTGCGGATTCAGCTATCgggacgacgacaactctACAGTAGTAGCGTTCGG
CTGGTGACCGCCGACCAATACCTGGAAGTCCCGGTAGGCGAGTCGGTAGAAATAGTGACccgctccagcgcctcagATCGACAGACGTTATGGCTTACTC
GTGGAGAGAGATGGGTGCCCACCGTCGTGAAAGTACTTGGACGATCGCAGTACCTGCGGATGACGAACGTGAGCGATCGTGGATTAACGCTGCACCGTGA
CACACTAGTGGGAATGTGGCTCACCGGAGATCGCGCACCCAGGCGTCCGGGTTTTGTGTCGCCAGGATCGCGTAGGTATGCCGAGTGGCAAAATCTAGCG
TACCAAGCGACGACCGAGAGATCGGGAGAGCTAGAGTCGGACGAACCGCCTACCGGGCCAAAGGTAGATCGGCCCAGATACGACACTCCGACCAGGATAT
TGACGCACCAACCCGATCGCTCAGGACGAAGGATTACTACGGTGGCACCACATCCCACGACTGGGAAGGGCTCGATAGAGAAATCGTCCGAGCCGAAATG
TGCTATCCAAGAGGAGTCTGGAAACCCCATCGAGGGAGACTCAGCTAAGGAGGAACAGAAACCGATCCCACCCAAAGGCCCGATCGATCTGAGGAATTCC
CCGACAGGTGCGCCGAGTGTGGGACTTGCGCCGCCCCCGCCGGAGTCCGAAACCCAGGGAGAGGATCAGATCTGCTACCACGAGGGCGGTGATTTAGCTG
TTGAGGACCTGGAGAAACAGGGGGCGATCCTCCTGGAAGTGGTAGCCACCACAGACGAAGTCACGATCGAGGATATCCAAGTTGGCGATCCTTCCCAGGA
CGCTCCTGAGGACATAGAGCGGTTGCGCCAGATCATCTGGAGCAAGCGCCACCTCTTGATCGGAAAAGGAAACGCCCTACCCCCGGCGGCCCGCGGTGCG
ATTTGCGATATCGATGTGGGAGGCGCGGCCCCAGTGGCGCAGCGTGTACGAAGAGTAGCTCCACAGTTCCGCGAAAAGTTTTCTGATCTGATCAAGGGAC
TGTTGTCCGCGAAGATCATCAAACATTCGACCTCTCCGTGGGCATCGCCGGTGGTGATCATCATAAAAAAGAATGGGGTCGACATCCGCCTCTGCATAGA
CTACCGGTTGGTGAACAGTCTGACCAAGCTGATGGTATACCCCATGCCGCTGATTAGCGATCTCCTGGAGGACTTGGACAAGGCACTCTGGTATTGTTCA
CTAGATATGGCCAGCGGATTCTGGGTCGTCTCCATGACAGAGCGTGCTCGGCTGATCTCCGCGTTCATCACACCTTTCGGGCTGTTCGAGTGGACGCGGA
TGCCGTTCGGCCTGAAAAACGCACCCCAGATCTATCAACGCTTGATCGATAACGCGCTGTATGGGCACCTCCGGATCGGCCCCATTCAGGATCAGACGCG
TCCGATCGACGTGTTCAAGGATGGTGAGCCGGAAACGGATCAGAGGCCGTCGGTATTGGGAAGGCGATCATACATCGATGATATCTTGATCACGGCTCCC
ACGTGGGATGCCATGTGTAGAAAGGTAGGAGACCTGCTGGATGCTTGTGATCGATGGAATCTGTCGATCAGCGTTGTCAAGAGTTTCTGGGGACGCCGCA
AGGTGGACTACCTGGGCCACCAGGTGTCAGCCGATGGTCTAGCGGCCAATCCGAAGGATCTGGAGTCTCTGAACAACCTGCCATTCCCTTGTACGCTGCG
GTCGATGCAATCCTTCCTGGGAAGCTTGAACTACTATAGCCGTTTCATCGAGGATTTCGCAATATATGCGGCGATCCTGCATGAATTGCGGGAGTCGGAC
TTCCATGAAATTCGCAGTCGAGAAGAGACAGGAGATCGACAAGTAACTGGGacgaagcaccaccagccagTGAGGATGACCGATGGGCGAAAGCCAGGAC
cgccttcgacttgctgaagacgaagattGTGTCGACTCCGATCCTACGACACTTCGATCCAGATCGAGTTCCGGTGATTGTGGTGTATGCTAGTAAGTGG
GCAATCTCCGCGGCACTTCTGCAGGAGCACGATGGCGTGTACTGGCCAGTAACCTTCACCAGTCGAACCTTGAAAGCGAACGAGATCAACTACGGCATCG
TGGACAAGGAGGTGCTTGCACTTCTGCGCATCTTGGATGTCTGCTACACAATCTTGGTCGGGAGATCGATCGTCGTCCTCTCAAGACACTCCACGCTAGC
GTGGTTAATAAATTCCGCTGGTCTGGATGGGAGACTGGGCAGATGGGCCGCTCTGTTGTCGGAGTGGTCACTGGAGATCAGGAAGTGTACGAAGGGCGAG
GATGAAGTACTGGGGACGATGGCCGCGAGCATCACGCCCCGTGCCGAAGTCGACGAAGCGCTGACAGCGATCGCaccgaagaagcagccgcGTCAGACTA
TCACCATGCCCCCACCGACGGTAGAGCCCGACGAGGGCCTCCTCGTCGCTAACTTTGACGGGTCCGCACGAGTGAAgcgaggcggcggcgcctACAGCGC
GATAGTCTGGAAACTCCCGGAGTGGACGATCGTGGCGGCTGCCTCGGGTTACGCAGCCGATCTGACCGTGAATGAGGCAGAATATAATAGATTGCTTCTC
TGCTTCGATCTCCTAACGAAGAACGCGGACAGGGGACGGGTCGTGATCTGCGGAGACTCCAATCTGGTGATCAGACAGATGCGCGGCGAGATAGAATGCA
AGGCCCCGGGCTTGCGGCTGTTGCGGCAGAAGGCGATGGATCGACTGCGCTCCTGGCCAACCCATGATTTCCTGCACGTGAAGCGAGATTGGAACCAAAG
CGCAGATCGGTTAGCAAGTGCGGCGCTTCAAAGGCAGGAAGGTGCAGTGATTACctcggacgaagagctgcaagatcTGATCACGCTGAATCGACTGAGC
GAGTTGCTCAAGCCGAAGACATCGGAAGCTGTGGTCTACGTGACCGCCGTCACTAGATCGGCGACGCAGAAACGACACCGGCCGGAAGTGTTGCAAGAGG
AGGTCGTCCGACGACTGCGAAGCGAGCGCATACGTCAAGcacaagacgaagaaaagTGGATCATCAATCTGAAGTCGTACCTGAACGGATCTGTAGAGAA
CTTGACGGCGGACGAAGCCAAGTCCTGTCGGAAGATCGCCGCCGATtacgaggtggacgaagccGATCTGCTTTTCTTCTGTCCcgactcctcctcctta
GACGCCGATCGCGATCTGGTTGCCCGACTCGTGATACCGGAgactctgcagcaggacATCCTACATCATTACCACGCTAGCCTCGAAGGAGGACACCAAG
GGATCGGCCGGACGTACCAGAGAATTAGATCGCACTTCCACTGGCGTGGGATATACCGAAGTGTCCAGCGCTATGTGGGAGAGTGCGCAGACTGTGAGAC
GGGAAAAGGGCGACCCTACCTGCAGGGCAGATCCCCAGGGAACATGCGAGCCACGTACCCCTTTCAGATAGTGGCGATGGACCATGTACCGTCGCTGCCG
AAGTCTTTCAAAGGGAACACGGAGCTTCTCATTTGGGTCGACCTGTTTTCCGGCTACGTGATCGCCAAGGCGAGCAATTCTCGGACGGCCCAAACGGTCG
CCGAGAATTACGAAGAGTGCGTCTTTAGACGCTTCGGCGCAAGCGAGGCCCTTCGACATGATCGTGAACCTGGATTCATGGCTGATTTCTTCCGGGCATT
CAACCGGATAGTGGGACAAAAACAGCGGGCCACGATGGCCTATCGCCCGCAGGCCAACGGAACAGCTGAAAGGATGGTGCAAACGATGACCCGGGCACTC
AAGATGTATGTCGCAGACGTAAATCAGCAAGATTGGGACGAGTACGCGGAGCGCTTGACCTTCGCGATCAACACGGCGCACGATCGCGTCCGAGGAGACA
CCCCGTTTTATCTGATTCACGGCTGGGATCCACGTACGACGTTGGAAGCCGCGCTGCCGCTGGGCAGCACGCGCCGTCGAGACGTCGAAGCCCGGCGATG
GAGGTATCACGTGCAGAAACAGTACCAACACGTGAGGGAACGAGTCAAAGAACGCCTGCGTGAAGCTATTCGAGACCGAGCTGATCGGCACAACGAAGGC
GTGAGACCACACAAGATCGAAGTCGGTATACAAGTTTGGCTATATTTAGACAGGGTGAAGGAAGGCTACGCGAGGAAGTTAGCCCACATGTGGCATGGCC
CGTTTCGAGTAGCTGAGCTCGTGGGAGAATACGCAGCCCGCCTTGAGACCGCGGGTACCGAGTACCGACTCTTCCCCGTGGTGCACctgtccaagttgaa
gcctGTCCGAGTCTTCCCTGACCGCCCGGAAACTGACCTGACGgtgaatgaagaagatcgcttCGATTTTGATGAGGCCTTGCTGCCGGAAGATAGTTGG
GAGGGTGTCCGAGGGGAAGACGAGTACGAAGTGGAGCGAATCGTAGACATGCGTACCGGACGCCGTACTCGCTACGGCCGAACCCATCGCGAATTCAAGG
TCTACTGGAAGGGATGCGAAGAGCCATCCTGGGTCGATGAGGCGGATCTAAATTGCGGGGCCCTGTTGCGCGAGTACGAGCGcgcgatggtggcgaagaA
TCGCTTCAGAATGATGCAGTCCCATGAGGAGGAGACGCAAGATCCGTAGTAGGCTGGCTACTATGGAAAGGGGTGTAGTGTGACGAGTGCACAGGGTGGC
TATGCACTGAGGAGGAAGGGCTGTGTATGTGGAGTAACGATCGAGCGTGGCCACACCTCGATCATGTGCGGGTGGACTACGCTCGATTAAAAGAAGAAAG
GAAGATGAACAAGAACGACTGGTGAACCAAGAACAAGTTGACCGAAGCGACGGACTCGTGGAGGCAAAGATAACACGAACCAAGCTGACATTGCGATATG
CAGTTGCGAGCAGAAAACCTGTGCTAGCCTACGATCTGGAGGCGCTAGCTCACTCTGGAGTGCGGTCGATTTTTCACGCGTCATTGaccgctgctggagg
cacGAATTTGTTTGTCAGACGATCGATTTGCGAGCCAGGATGATTCTCGATCTGACCGCGGTACCGGATGCGCCACGGCTCGGCTGCGTCCACAGCTCTC
AGCGCGTCAGCTAGGCTGGTCGGGCGGGGGCTCATTCCGAAGCCAGGATACCAGCTACGCATCTCACCTGGCCGCGGGTAGTTCAAGAAGTGCGGATCTA
GCAAGATGTCTAGATCGTACTGGCCGGCGATGATCGACGCAAGCACGCGTTTTAGGAAGGCCTTCCAGCGCGCCCCGAGTCGGGATCGACGCTGCTTCCG
ACCCGTCCAGAGCTTGGCCAGGAAGGGGAGCTGTTTGCGGAGAAACGAGCTGATCTGGAATGCGTGGGTGGACTCCCACAGGgcctgctggtgctcgctC
ACGAGCTCTTGATAGCGAAGTGCATGGGGGGCAAACCAGCCGTCGAGCCGAAACGATCGGGGAACCACCGATCTATCGAACACAGTCCACGGCTTAGTAG
CATACACCGTTTTGACCTCTTGCTCGGTGATCAACTCGGGGCACCACTGACGCGGACGTGGTGCCCTGCCACGCCTCGGGAACAACCAGCCCTTAGGCTG
GGAGAAGTGGTGGAACAGCAGTTCGATGTCCAGCTCTAGAACACTTATGCGTCGGATCCGATCGGGGCTCCAGGGGGCGATGGCGGCAGCTGGATATCGG
CCACGATCTCGGTATCCTGGGATCCATTGATCTCGAGGAACCACAGTGGGGGCGAGCTGCGCATACCCAGCCGCCGGGAGCAGAGTGTTGCGATGAGAAC
GCGGAGCGCTGACGATGCTATCGTCACTGCCTGCACTCCCGTCGTCCTGCCCACTGCCGGCCGCCGAGTCCACCTGGCCGCCATCCGAATCGGCAGCCTC
GGTGGCCACCTGACCGATGTCGCTCTGGTCGTTGACTGACTCAACTCCCGTGGAAATCTCGCTACTGCTGTCGTCGCGATCCGCACGGGAGTTAGGGCTC
GGACCAgcgtggctgttgctgccttcgctGGACGAGTCGAGGCTGATCGGCCTCGTGGGCGATCCACCGGCGGTAGTAACGGAGGatcgacggtggcgac
gggTGGCAGTACGAGATTGGGCCAGCCCGGCACGAAGGGGATCGTCGCTGTCGGGGGAAACCGGAGGCTGGCGCGCTCGATTAGGCGTAGTCCGGCTACG
ACGGCCACCGCGGAGGCGCCTCCCGGGGACGGACGCCGTGGATCGACTGATAGACGAAGTAGAGCGACTCGGCGAAGATGGCCCGAGCGAGTGTCCCGAA
CTGGGGGCTGCCGAGGAATCCGATCGCGGCTGTGGAGtccgcaatggcgacgaGATCCGTGGACGGCGGCGCGGAGGGGCCGACGAACTAGCGGGGGCAG
CCGACTCACTGCGGCGGCGTTTGCTGGTGGAACCACCCGGCGAAGTTTGAACCGACAAAGGTTGATTCGATCGCGCCGGGCGCCCGGACGGAGCTGAATC
CGACGTGATCGGAGCACCTGCGGAAGATGCCGGCTGGACGAGGTCGACTGAGCCGGCCACACGAGCACGGATGGTGTCTCGTTCTCGAACCGCGCGATCG
CGATCGTCCTCCACCTTGGCGCGCACATCTTGAGCAACGGCCAGCTGCGTCGTAAGAGCCGAATTCTCCTGCTCGAGCATAGCAATACGCTGGCGATCTA
CCTGCAAGTCGCTAAGGCGGCGCTCCAGCCGCGCAACGGCTGACCGGGAGGTGCTGATTTGTGACTCTACATGCACAGAGACATGAGCCGCGATCATCAA
GTCAGGAGAGGAAAATAAGATCGGCGAACCAGAGGCAAGACGTACGGGTGGTCTGCAATTCTGAGCGAAGGCGGTTGCGCTCGCGAATGGCCCGCTGGAG
GTCGGCGGAAGCAGTGACACGTTGTttgtcgatgtcgtcggcGTGAGCGCGCAGGCGATCACGTTCCGCGTCATTTAAAGCCGCCTGACGCGCGGCCTTG
CGTGTCTCGTTACCCAACTTGGACCGGAGATCGGCGGCCTGCGCCTCCAACTCCGTTTTCTCGCTGTGCAGTTGAGAAATAGCATTTTGGAGCGCTTGCT
GGGACGACGCGTAGGCTTCGACATCGCTCTGGCTACGTTGAGGACCGCGCTGTGTCTGGTCGAGCGAAGAGACTGCTGCCGCTAGCTCGGCTCGCAACGC
GACGACTCGCCTGCCGAGCGCCTGAGTCCGGGAAGTCGGAGGTGCAGGGGCGGCAGGAGGAGCTGTGGGAGCCGCGGCTAGCCGCACCCGGAGATCGGCC
TCACGAACTGCTGCCGAGTCCAGCCGCGACTGCAACTCGTCGTTTTGAGAATGGAGCCAGGCCACCGCCTCCTCGTGTGCTTGCTTCTCGGTCCGGAGCT
TGGTGCGAAGAGTCCTCAGCTTCTGGGAATTATCATGCCGGTCTGCGAGCGCTGACTTGCAGTCCGCGAGTGCCACTTGGGTCTCCTGCAGATCACGGAG
CGCACGGTCGTAACGACCTAGGCAGAACTGGACAAACGGGGCCGCCGACGCGGCTGCTTCGTCAAACCGGCGCTGTATGTCCGCACTCCGTGCCTGCTCA
TCGCGGTAAGCCTTTTGCAGATCGGCGTGAGCTTGTTCCAGGTCGTGCTGGGCTTCTACACGAGGTAAAAGCGCGGATAACGCCGCTATTGACGTCTGGA
TCGCGGCGGAGTCAAATTCGGACCACTGGACTTGCAACGTAGACGCCACGAGACGGGAAGAAGTGTCGTCGAGGGGCGGCGTGGCTGACGCGGCGTCGGG
GAGCCCTGCCCCAGCGGCggagttgctggacgaggaagacagCGACATGACCCAGGTGCGATCACGGCACAattggcgaaggcgaagctcGTGACGATGT
GCTCGTGCCAGTCGCTGTACGACCGCCGCTCACACAGGGGACGATTGTGGCGACGCGGGtagcaagaagagcacccAGGAGCGATAACAGGGTGATTGGC
GTCAGGGAACCTGAGATCGCGTTTTGAGGGATCGGGACCACATGTCGCAGCCTACGTGTGCAAGCAATCATTCGGGGTCGGTACCACCAGTTGGGTACAG
AGCGATCATATAGACACTGTACCAAGACCTGGGTACACCCCGATCATATTGGGACGTGGATACATCCCGATCATGTTGGACATGGGTACAGCGCGATCAT
ATTGGCATGCCTGTACCCCGATTTGGGTACGCCAGCAATCACGAGTACACGGACGGAACGAGTGGCTAAGGGTGTGAGGTGGGACGAAGGGTAGCTTGGG
TATAGGTTTATTGGTAAAAGACAGATTCAGACTTTCCTTCTAAGACACACGTGGCATCTTTTCCGGGCTGGGAAGCATATTGGCCCTCCCGACGACCAGG
AAGCCGCTTAAGTCTACCGAAGAGAACGTGTAGTGATCGCCTGGATTGCTTGGC