Description :
From Genome Similarity Track
Location :
Scaffold_2433:1- 1163
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_2433-fgenesh-gene-0.0HECT E3 ubiquitin ligase

Sequence
1162 bases(100 bases per row)
CAAGGCCGTGCTCTATGCTGCTTTGGAGACCGAATTATACGGGTTTACGACCAAGTAATAGCCAAGCAATCCAAAGTATCTATGTCCCAAAGTGAGAACG
ACGGCGTGACCAAACGTCGGAAAAGGACACTCTTGCAAGCGAATGTGTGTCAAATGGGTTGCAAAACGAAATGCGGGAAGGACTGTTGCCGGTTTTGGAT
GTTGTGTGAACTTTAGTGGGATAATGTGATTTGTCTGTGTCTATATGGGAGGCCAAGTTTGACAAAAAGAAAGACGGTAAGCAAAAAAGTTAATACTGAT
TTACACGCGTTTCCAACTTGGGATGTGGGTCCTCGCTGCTTGCATCTAGATACAGGATACCTTTGCACAAAGGCGGATAGTGCACCTACAATCACGTCCT
CGGATTGGTCACCTGACTGGGTGCATTTGAGAGAAAAGGTCTATTCCATGCTAGTTTCCATTTTGATTTGACGGGATGGATCCCAGCGTATTGCGAACTC
CCACCAGCGTTCTTCTCCAGTTAGGCTCGCGCCATTATTTGTTTTCCGCGCTGAATCAACAGCACGACGATGGCGGGCTTCCTCGTGACAGTGCTCACTG
TCGTGACCGGAGTGCTAGGTATCTCAGGCCTCATTGCTTCGTTCATATGGTGCCTGAACCAATGGGATAAATGCATCCACAAAGATACAAGCGATGACGA
CGACAACAATTTGCATGCGCCGCTTGACCCCAGGTACGCTCCTATTGTTGCTACTGATATATAAACCACGGTTGATCTTTTACCACAATGCAAATAACAA
TGAGTTCGATCGATGTTATTCGCAGCTCCAACACCCATCGACTAGACGCAGCACTAAGGTTGGTGCAGACGAAACGGCATCATGTGCTGTTATGGCCTGT
TTACAATCTGTATGTCATGGTGTTGTTTCTTTTGATAGAGAGGCAGAGTCTCAATGTCTCGTATGCGGTGTGTGTGGCTTCGAGAATTTCGCAACCACAC
CCATATGCAGTGTCTGCGGTGAATCGATCGCACCTTCGGCTGACGTTAGTGAGACGACCACAAAAAAGTCCTGGCGCTGGGTGACCAAGAAGAAAAACAA
GACGAACACTCTTGAGATCGAGAAGGTGTCATCGCCACGAACTCGGGACCCACTGACATACA