Description :
From Genome Similarity Track
Location :
Scaffold_2606:1- 1150
Transcript NameFunction/comments
Phymu_g14221reverse transcriptase

Sequence
1148 bases(100 bases per row)
GATCACATACCGTCTCTACCCAGATCGGATAAAGGAAATACTGAACTGCTGATCTGGGTCGATCTGTTCACGGGATACGTGATCGCGAAGGCCAGTTCCT
CCCGATCCGCGCAGACGATCGCTGAATCTTACGAAGAATGTGTGTTCCGCCGATTCGGTGCGAGCGAGATGATCCGGCACGATCGGGAGCCGGGATTTAC
gtccgacttcttcaagtcgttCAATCGGATCCTAGGGCAACGGCAGCGAGCAACGATGGCCTATCGACCTCAAGCTAATGGAACTGCCGAACGAATGGTA
CAAACGACGACCAGCGCGATCAAAATGTACGTCCAAGACCTGGATCAGAAGGACTGGGACGAGTACGCCGAACGGTTGACGTTCGCGATCAATACCGCCC
ATGATCGGGGCCGAGGAGACACTCCCCACTATTCAGTGCGTGGGTGGGATCCGCGATCTACGTTGGAAGCGACGATCCCGGTCGGATCTACCAGACGTCA
TGGTCGCGACTCGCGTAAGTGGCGTTATCGGATCCAGAGATACTATCAGCAGTCCAGAGAACAGGCCAATGCCAGATTACGGGACGCCATCTCGGATCGG
GCCGATCGGCACAACGAACACGCCGATCCGCATCAGATCGAGGCGGGATCCCGAGTCTGGCTGTATCTCGATCGAGTGAGAGAGGGTTATGCCCGTAAAC
TGGCTCACCTCTGGCACGGCCCATTCCGGGTcgcggagaagatcaacgagttcacgatgaagctcgagatcgcGGGAACAGGGTACCAGATATTTCCCGT
GGTCCACgtctcgaagttgaagctggtgcgGGATTTTCCGGATCGGCCGCGCGTCGATCTGACTGTTGATGAGACGGATCGGCTCGATATCGATTAGATC
TTGCTTCCTGAGGACAGTTGGGTGCCAGATCTGGAGGCTGACGAGCACGAAGTCGAGCGGATCTCGGACATGCGAAGTGGGAAAAGAACTCGTTACGGTC
GGATCTACCGAGAATTCTTGGTGCACTGGGTCGGATATGACGAGCCGACCTGGGTCGATGAAGCCGATCTCAACTGTGGAGCTATACTGAGGGCGTTCCT
ACGGGATCACACTAACCGTAACCGGTTCGGTGTGATGCAGTCGCACGA