Description :
From Genome Similarity Track
Location :
Scaffold_3651:1- 1150
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_3651-snap-gene-0.0Conserved gene of unknown function

Sequence
1149 bases(100 bases per row)
TTTCTTTTTCTTCTTCTTCTTGTTTGACTTATTGGCCGAGGTGTCATCCTTGTGTTGGTCGTTCTTGCAGCTCTTTGTGTCCTCCAACGACACTTCTAAC
AGGAGCTGCTCCATTTGAATGGCTGCCTGTTTCTCTAAATAGTTCACGTAGCTTCTTAGAATGAGCTGCGCATACAAAGCATAGTCGGATTAGTATCTAA
TACATAGACCCTCGAGGGAACCACAGCAATTATGCACTTACCTGCTCGATAAGCATCGCGATCAATCGTTGATAGTCTTCCCAAGTGTTGATGACTTCAC
TCTCGGATACAAAGAGGTCGAGAAACTGCTTCTCATTAAGCAAATGGACGGTCGTGACAAATCCAAAGAGTACTTCTCCGACAAGACTAAAAAGCCTTCC
AGGATCTTCTACCAGCTCACTTTTCACGGTGAGAATGCCTATCGACCATTCACGATGTTTGTTAGAACCCACATTACAGTTCCTGCTGAGTAAGCTGAAA
CAAAAGCATATGTTCACTTTACCGGTGCCGATGTCCATAAATTCCATTGCCTCCAAGAGCTCATACGTCTTCTCAGCAGATGGATCTGCTTCCGCAATCG
ACGACGCATTCTTTGAGACAGCATTCTCAGTAGTTAGAGTAGATGCTGGGGTATCTCCTGCTGGTGAAGCTGCGGTCGGAGTGCCTTCTATTGCTACTAA
GGATGGGGTCGGTCGAGGAGTTGTAGCCATTTTCGACGCACTTTTTGTTACAGCAGATCGCAGAGGCATCTTCAGGTGGCGCTGCATCAACCCAACGCAG
AGCAGGCTCAGGTTGAGCTTGTAGAGCTGCTTGACGAGATCTGGTTCGTCAACAAACAGGATCTGCTGGCGTTCATTCGCACTAAGTTGCTCCCAATATC
TTCGAATGCGATTGGCAGCCGACGAATCTTCATCTGATGTCGCTCCGCTATATGGCACTGCCGTCCAGTTTGACCCGTTCGCCATCACATTCCCAGAACG
AGCATATATATTGGAAGATTTGGAGCGCTTTCGTGACCGTCCATGCAGCAAACTCGCGCTGCCACCAACTTGCTGCCTCCAACCTGCAGCCCCTCCAACG
CCAATCTCCGTGCGCACAGCCAGATAGCTTTTCCAAATCGGCGCTGTAA